GenePrediction:GLEAN_5674 Details

Name: GLEAN_5674
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1663878..1661320 (- strand)
Length: 2559
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1663878..1663842 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_173:1663776..1663134 (- strand)
Length: 643
Type: CDS
Source: GLEAN
Position: GCSC_173:1663081..1661320 (- strand)
Length: 1762
>GLEAN_5674 class=GenePrediction position=GCSC_173:1663878..1661320 (- strand)
ATGGCCGCACGGAAGCTCAACGTGCTCGTCTATTCGGGTGAGTCAGTAACAAAAAGAAGGACTCTGCATAACTGCTGACT
AATCAATTGTGTCCCTCTGCAGGTACCGGCACGACATCCGAGTCAGCCCGGCACTGCCTGCTGGCGCTCCGACGGCTGCT
GTATCCGAACCACGCGGTGATACCGATCAACGAGGCCGGCTTGACCAAGGAGCCATGGCCGGCGACGTGTGCGCTGCTCG
TGATGCCGGGCGGCGCAGATCTGGGCTACTGCCGGGTGCTCAACGGCGCGGCCAACCGCCGGATCAGTCAATATGTCCGC
GGCGGCGGGCATTACCTGGGCTTCTGCGCTGGAGGCTACTATGGCAGTGGCGTGTGCGAGTTTGAGGTCGGCAACCCGGC
GCTCGAAGTGGTTGGTCGGCGCGAATTGGTCTTCTTTCCGGGAATTTGTCGCGGCGGCGCCTATGAAGGCTTCTCGTACC
GCGACGAGTCTGGCGCCCGGGCTGTGCAGCTGGCCATCCATACCGATTCTTTCGGCGCCGTGTCCGACACGTTGCCATCG
ACCTGCTGCAGCTACTACAACGGCGGCGGCGTCTTCGTGGACGCGGCCATAGCCGCCAACGTGCAGGTGCTGGCCAGCTA
TCCCGACGACATTGCCGTCGATGGCGGCAGCAACGGTGGCCGGGCAGCCGTGGTTTACTGTGCTGTCGGTGAAGGTGCGG
CCCTGTTGACGGGGCCCCATCCAGAGTAAGCAGGCAAAAGGAGCAGTCTGCAAATTTCTCTCGCTCACTCTTGTCAGATT
CGAACCCGCCAACCTGTCCGAGCAGCCCGACCTGCCTGGCTACAGTGCCATTCTCGCAGAGCTGCGGCACGATGACGAGC
TCCAGGCGCGCTCCCGCTTCCTCCGCGCCTGTCTCGTCAAGCTGGGCCTCGACGTGGGCAGCGGCAATGTTGCGTTGCCG
CGTTTGACCTCGCTGCACGTGACCTCGCTTTACCCAGACGAGGCTCAAGAGCTGGTGCAGGCGTGGGACGAGGTGCTGAC
GCGCGAGGGCAACGACATGTTCTTCCGCGGTGGTGACACGTTCCGCGTACTGCAGCCCGACGTCGGCACGTCGGCGTGGC
CGGCAGCCCTGAATACGGCCGTTGGCCCGGGAAAGCACCAGCCGTTCTGCACGGCCATGCTGATGGACCTGGCCGACCGG
GCGCTGCGATACCCGAAGCTGGCGGCGCTGATTAAGCGGGTGGCCGCCATCAACAACACATCTGCGCCGGACGAGGACCA
GAACACGTTCCGAGCCGTCCTCGGTGCCGTGGCTGCGCACGAAGAAGAGGGAGGAAACCCGTCAGCAGAGCGAGGCGACA
GCAGCCAGCGACGCGCGCTGTTTGACGACATGGTCGACGCAATCCGCCGAGCCGTAGCGCAGGTGCTGCCTCGCGATGGA
GCCGGGGCCATGGTGACGATCCCGGAGCTGGACCTGGCCGTCCGACAGGAGATTTGGGCCGGTCCGCAGCACTCGGGCAC
AGCAGAAGATGACGATAACGAAACGGTCCGCCGGCTGATCGTGTACGAGGCTACATGGCCGACGCGCGTGGCCGCCTTCG
ACTACGGCACCTTCTACCGGGCGCTGGAGCACTACCGACAGACGCTGCCGACATCAGCCACGGACGGGCACGAGTTCCAA
TGGGGCAACCAGCTGATGTACGGCCGCGTGGTCGGCAGCACCAACACGCTGCTGGAGCGCAACGGGCGACTGACGGCGAC
GCTGCCGACGGGCTTCACGCTAACGGCGACGACACAGCTAGCAGGCCGTGGCCGCGGCGCCAACGTGTGGCTAGCACCCG
ACGGCCAGCTAATCCTCTCGACGGTGATCCACCACCCGCTGCGGTTCGCCGCGGGTGCCGACCGGCCGGTCGTCTTCCTG
CAGTACCTGGCGGCCATTGCGATCGTGGAGGCGGTCGAGGCATATGGCCCCGGCTTTGACCGTCTGGGCGTGCGGCTCAA
GTGGCCCAACGACGTGTACGCGCCCGATCCAGACGCGAAAGGGGGGTCAGACGCGCCGTATGTCAAGATCGGCGGGATCC
TGGCTCACTGCTCCTATGCCGACGGTCATTACCAGGTCGTGCTGGGCATCGGGCTCAACGCGACGAACGGACGGCCGACG
ACGAGCCTAGCAGCACTTGCGGCTCGCCACGGACTCGGACTCGGACGCGAACAGCCCGCCAACGACGCGGTCGTGCTCGA
GCGGCTGCTGGCCTGCCTCCTGACCCGGCTCGAGGCCGTGTACAGGCAGTTTTGCCGCGACGGCTTCAGCGGCGACCTCG
AGACGCGCTACTACCGCCACTGGCTGCACGCAGACCAGGTAGTCACGCTCGAGGCCGTCGTGGGCCAGCCGCGTGCCCGC
GTGCTCGGGATCACACCTGACTGGGGGCTGCTGCGCGTGGCCGAGGTGGTGTCGGACGGGCCGGGCACGACTGAGCGGTC
GACCGGACGGGTGTGGAAGCTGCAGAGCGACGAGAACAGCTTCGACTACTGGAAGGGCCTGATCCGGACAAAGACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62