GenePrediction:GLEAN_5675 Details

Name: GLEAN_5675
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1656499..1655052 (- strand)
Length: 1448
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1656499..1656174 (- strand)
Length: 326
Type: CDS
Source: GLEAN
Position: GCSC_173:1656112..1655871 (- strand)
Length: 242
Type: CDS
Source: GLEAN
Position: GCSC_173:1655814..1655606 (- strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_173:1655480..1655052 (- strand)
Length: 429
>GLEAN_5675 class=GenePrediction position=GCSC_173:1656499..1655052 (- strand)
ATGTCTGACCCGTCGTCTTCGGCCGCGGCTGAAGCTGCGGCAAAGGCAGCTGCCCATGCCGTCGCCAAATTCAACAAGGA
GCTCTGGACGCTTTACGGCTTCGGCATCACCTTCACTCTTCTGCGCACCTATGCCCGCGTCAAGGCCCGCGGCTTTGGCG
GCCTCGCCATTGACGACTATACCATCTGGGGCGCCATCGTCTTCTACTCCGCCCAGTACACCCTCGCCTTCTTTGCCGTT
AACCATGCTGGCGGCATGGCCAACAATTCCATGACCGATCCCCAGCGCGCTGCCCTGGACGTCAACTCGACCGAGTACAA
GCACCGGTATGGTTTTCTGTCTCTGTCTCTGTTTCTCTCTCTCCCTCTCTCTCTCTGACAAGCCTAGTATTCTTGGCTCC
AAGATCCAGGTCGCCGGCTGGACCATGTACATCTGCCTCATCTTCCTGCTCAGAATGTCCATGTTGGTGTTCTACACCCG
CCTGACGGAAGGCCTGGGCCGCACGTACCGCATGCGCATCAACATTGGCTACCTCATCATGGTCTGCACCTTTATCGTCT
CCATTGTCACCATGTACAGCTCCTGTCGTCCTCTGCGTGGCTACTGGCAGATTAGCCCGAACCCAGGCAGTAGGTTTTCT
GACTCTCCTGTCTCTGGAGACAGTCATGCTGACAGGCTTGCCCAGAATCGTGCCAGGCTGCCATCTCGATGCCCATCGTC
TGGTCCACGTTCTCCTCCAGCATCATTGACGATCTGTACCTGATCATGATTCCCCTGCCGATGCTCTGGAGCACCACCCT
GAAGCCCATCAAGAAGATTGCCTCCTCTTTTGTTTTGGGTGCTGGTGTTTTCGTCCTGATCTGTTCTCTGCTCAAGACCG
TCTTCGTCATGACTGTAAGTGTTGAGTGGAGAAAAAAAAGAAAGCAAAAGAAAGCAAAAAGAAAAGAAAAGAAGAAAAGA
AACGAAGAAAAGAAACGAAACGAAACGAACAAAAAGTAAGCCAATCTAACTCTTCCTAGGACAGCGTGAACGGCGCGACT
CTGGCCGGTTCTTGGGGCACCCGCGAGTCCTTTGCCTCGGTCATCATCACGAACCTGCCGATGGTGTTCCCGCTGATACG
ATCGCTGCTGTCGCCTGTGTTTGGTGGCCTGCTCTCCACCCAGAAACAGCAGTACAAGACCCCCGGCGGCTTCCGCACCA
TTGGCGGCGGCACGTCCAACATCAGCGGCCACACACGCAACGGTCGCACAATGGCCGCTAGCGCTGGCGGTACCAACCTA
TCGATGAACGAGAGCGAGGAGCACATTGTGCGCGGCATCCGCATGGACAACATGAACGTCTTCTCCGGGCAGAGCAGTGC
CGACACGACCGTGCCGCACAAGGGCATCGTCATGACCAACGAGTTTGAGGTGACGACAGACCAAAGCAGCATCAAGCACG
AAGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62