GenePrediction:GLEAN_5676 Details

Name: GLEAN_5676
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1653436..1652250 (- strand)
Length: 1187
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1653436..1653095 (- strand)
Length: 342
Type: CDS
Source: GLEAN
Position: GCSC_173:1652999..1652250 (- strand)
Length: 750
>GLEAN_5676 class=GenePrediction position=GCSC_173:1653436..1652250 (- strand)
ATGGCCCAGTACTATGGCGGTCCGCAGGGCGGCAACCCCGCGTACGGAGCATCTGCACAGAACCTGCAGTTCTACCCGTC
AACCTACTCACCCGGCGTGCCGGGACAGGCGAGCTCTCAGCAGGGCGCCTATGGCTACGGTGCCCCCGGAGGCAGCGCGC
CCGCCTACGGAGGCTTTGGCGGCAGCGGTGCCCCGGGCGGTGGAGCCGGCGTATCGGGTCGAATGGGCGAACAAGGCGGA
CTTCGCACCGGTTGGCTCGCAGCCTTCTCGACTGAGGGTTATGATGGCGAGCCGCCGCTGCTGGAAGAGCTTGGCGTGAA
CTTTTCCCATATTCGAGCCAAGGTATGTCATCTTTCGTCCTTGTCGTCCTCTTTCCTCTTTCCTCTTTCCTCCTCCTCTA
ACCCTTTTACTTCCCTCCTCTAATCTCAACCTCCCAGACTCTCGCCGTGCTCAACCCCTTCCAGCGCATCGACCAGCATC
TCATGGACGACTCCGATCTTGCCGGTCCCATCATCTCCTTCCTCCTCTTCGGCACCTTTCTGCTCTTCTCTGGCAAGGTC
CACTTTGGCTACATCTACGGCCTAGCTCTTCTGGGTTCCACGTCGCTGCACATCATCCTATCGCTCATGTCGCCCGACGG
CCACGTCGGACCGGCTGCGGCTGCTTACGGCGTGCCCCCGGCGACGCCCTCGACGCCCGCCTATCCAGACACCGGCGGCA
CCGGCAGTGGCGGCCGCATCGGCAACAGCACGGGCGTCAGCGGCAACATCGGCAGCGGCAGTGGTGGTCGCGGCGGCAAC
AACAACGGTGGCAGTGGCGGCAACGGCGGCGTCGGCAAGCACGGACGCAGCGCCAGCCTCAGCCACCTGTCGAGCACCCT
GACGTTTCCGCGGTCGGCCAGCGTGCTGGGCTACTGCCTGCTGCCGCTCGTGGCCACAAGCCTCGTCGGCATCGTCATGC
CCATGGACACGCCGCTGGGCATCGTCATGACCACGGCCGCCATCTGCTGGTGCACCTACAGCGCCTCGAGCATGTTCTGC
GCCGTCGGCCGTATGCGTGGTATGCGCGGCTTGGTCGCTTACCCGCTCGCGCTCTTCTACGTCGGCTTCGGCATCATGGG
CGTCTTTAGCAGTCGTGGAAGCGGATCCATGGCCAAGGTTATCGGTGGCCGCGTGGGGGGCGCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62