GenePrediction:GLEAN_5677 Details

Name: GLEAN_5677
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1648763..1646067 (- strand)
Length: 2697
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1648763..1647623 (- strand)
Length: 1141
Type: CDS
Source: GLEAN
Position: GCSC_173:1647554..1647363 (- strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_173:1647299..1647144 (- strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_173:1647077..1646348 (- strand)
Length: 730
Type: CDS
Source: GLEAN
Position: GCSC_173:1646130..1646067 (- strand)
Length: 64
>GLEAN_5677 class=GenePrediction position=GCSC_173:1648763..1646067 (- strand)
ATGACTTCCAGCTTCAAGAACAAAGCTTGGGGATGGAGATGCAAGGTGCTCGGCTCCAAGGACGAGAAGTCCCTCTCCGA
TTTCTCCAACAACAGCACCGATTCGGAGAAGAGACCTGCCGCGGTCAAACCCGTCAAAGAGACCAGTGGCGCGGCTCTTG
TTGTCAAGACCATGTACGAAAGCGACATGCGGCATGGCATTTACAGCTGGTCGGATTACCCTCCCCGCCAACAGAGCAAG
AGGGACCTCAAGAACCTCGACCGCGTCGCAATCAAGGTGTACAAGATCAAGGACATGGATAGGCCTGTTATCGACGGTAT
GCATTCCCTGAAGCACCACAAGATCAGCATCCACAACCTGGCGCTCGTGGCTGCTCTCGACCCCATCTTGCGTGCCGAGG
ACTGCCACCTCGACACAAACGAGCCTGCCGAGTTCGAAGCACCCTTCCAGCCTCTCTTCTTCTGCTACGATGCCATAGTG
GCCGCAATGCGCAGCAGACCGGATGCCGACCCGCTGAAGCCATTTCTGCAGCTGCTGGTCTGCGTCATGGACGAGGTGTT
TGTCCACACGTGGAAAAAGCGCCGCCAGCTGGCCGACAAAGGCCTCATCTCCTTTGAACATGCCTGGACATACTTCCAGC
GAGGCACCGTTGTGCGCAGCCACGGCACCAACAGCGACGTCATCAGCCGTGTCGTTAGGACAGCCTATGTGGAGCAGATG
TGCGAGCGTGTCCTTGCCGTGACCGTCCAGGCGCTGCGCTTCAATGGCGAGGCTTTTGAATGGGCTGAAAAGGATTTGCA
CATCGCCAGCTTTCCGGGCAACCGTCCGCTGTCCAAATTTGACCACTGTCCAATGTCACACGTCAAGGACGGCAAGTTAA
TCATGGAGCACATGGCTCGACGTGGCCGCCGGGTCCTCGACCTGCAGGGGTTGACGTACTGCAACTACGAAGGCGTGGGT
ATTTTCGATGTGCCCGAGGGCCATACAGAGAAGCATAACGTTGACGGCCGCATCCTTGTCGACGTCGCCGGCTTCAACAG
ATATAAGCTGGCACAAGGTTCGCGTGAAGGCAAGGACAGCGTGTCAGTGCAGAAAGTCGTCGAAGGCACGGGTCGTATCA
CAGGCGTGTCTCAATACAGAGGTGATCTCATATTTTCCCGTTCTATTCGTATCTGTTGGTTTTCCACTCGCTCACATAAC
ACATCGCAGGCACAGTCGATCTTACTGAAGACAATCTGACCCCTAAAAAGGACACGCCCCTAAAGTCAGCAACTCTGATG
ACTGGCCGACTCAGCGAGGAAGAACAGGCCACGAACAAGGCGACGATGCTTACTAAGCCCGAGGACCTCATGTTCATCTC
CCCCCTGATCGAAGCGTATTCGCTTAAGATCAAGCTCTGGTGTATGTCGAAACACGCCAGAAAATGAGATTGGGCAACAG
CGGCTAACCGTGAGGCTGCCGCAGTGATGGTGTATGTTGAGGACATCCGACCGATCAGATGGAACGACCAGGCCTACGAC
CACCTCGTCTATGACGAGCAGCAAAAGGATCTCGTCATGTCCTTTGTCGAAAGCCACGGCCACACGAGAAGCAGAGTGGA
TGATGTCATTCTGGGCAAGGGTAGGTCTTGTCGACTAGGGTGACGTGGTGCTTGTGGGTTGATGTTCTGATGCTGACGAG
CTGCAGGCGAGGGCCTCATCGTTCTGCTGAGCGGGCCTCCGGGAACAGGAAAGACGTTGATGGCGGAAGCCGTAGCCGAC
CGCACACACCGGCCGCTCTTGTACCTGCAGGCAGAGGACCTGGGCATCAGTGCGGCAGTACTCGGGGCCAACGTCAAGAA
GTTCTTTGAGATGGCCACCGAGTGGAACGCCATCATCCTGTTGGATGAGGCCGACGTGTTTATGGCAGAGCGCCATCCGC
AGGACATTGCGCGCAACGAGCTGGTGTCCATCTTTTTGCGCGAGCTCGAGTACTACCGCGGCATCATCTTCATGACCACC
AACCTGTTCAGCTCCATCGACAAGGCCTTTCGCAGCCGCGTCAGCTTGCACCTGTTGTTCAAACCGCTGCTGCCCGAGGC
TCGCTTGCTGGTGTGGCAGAAGTTTCTGGTGCGTGCGACGGCAGCCCGGAAGGAGATGCTCGAGATGTCGCGTGTTGTCG
AGGTGGGCGCCGTCGAGCATACGGCTCAGGGAGATTGGCTTTCGCGTGGCGTATCGGGATCGTCCATCAGCAACGATGAT
CTCAAGGAGCTGTCGGCCTGGAGCCTCAACGGGCGTGAAATCAAAACGGCTGTCACCATGGTGACGGCGTGGTGCGAGCA
CAAGGGCCACGATCTGACGCTAGAGCGGCTGGAGCACGGCATCCAGGCGACGTCGCCTCACGCGTCAAAGGCGGCGATGG
CAGAAAGCGACGAGTTGTATGATTGAGGGTATGCTTTTTGTTGGCTTTTGGTGTGAACTTTTTTCCAGCTTCTTGTCGGG
CATAAGTCGGGACACGTTGAATCACATTAATGAGAAAAAGCCATGTGTTCGTACCCGTCGATCAGTTCTCGAAAGCTGAC
GGTGGCATTTCCAGTGCAAAGGCCACCCGCTTACGTGGCCGCCGTGCTCGTACAAACGACTGCAAAACGACAGAAACGGC
CCCGATCAGGACGAGCAGGGCCTGGACGCCCAGAAGCACGATCCACACGCGGTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62