GenePrediction:GLEAN_5678 Details

Name: GLEAN_5678
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1645174..1644718 (- strand)
Length: 457
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1645174..1644935 (- strand)
Length: 240
Type: CDS
Source: GLEAN
Position: GCSC_173:1644765..1644718 (- strand)
Length: 48
>GLEAN_5678 class=GenePrediction position=GCSC_173:1645174..1644718 (- strand)
ATGGCCAGACAAAGCCAGCCGGACCTGACACGCTCGCGAGCGACACAGCTCCTTCTGTCGTCAGAGCAGGAGCAGACACT
CCACCCCCCACTTTGCCGTTTGCCAAATCACCTGCTCGGCCTGCTGCCCGCACCTTCCGCAGCTTGCATGAATGCTGAGG
CGACGTACTGCTACCGTATCACGACTCCTCTACACAAATACTCGCGCTGGAACAGCACCGCCTTTCTGGCACGTATACGA
GTAAGATACCTCCCGCCCAGCGTCGCATTACGTACAAGTACGATGCAGCCGGGTCGTCGCTTCCACCGGTACGTCAGCGT
ACAAAGGGAAAGTGCGCTACCAGGTGACCTCGTGCACACCAGCGCGTACGATCGACCGAAAGGGTTCCCCGTTTCCCTCC
ATTCAGCAGTTAGCTGGTGACCTGCTTCTCTGCGAGCAGCAGCCGGCACTCGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62