GenePrediction:GLEAN_5679 Details

Name: GLEAN_5679
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1644174..1643455 (- strand)
Length: 720
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1644174..1644030 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_173:1643962..1643911 (- strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_173:1643853..1643670 (- strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_173:1643607..1643455 (- strand)
Length: 153
>GLEAN_5679 class=GenePrediction position=GCSC_173:1644174..1643455 (- strand)
ATGGCAGAACTCACAAAGGTCGACTCCGCCGTCCAAGGCCTGTCATCATCCCCGCCGAAGCTCTCCTCTTCCCCACCAAA
GGAAAAGGGCCACCGGAGACTGAGCTCCCATGGCAACCCTGATGTCCGGAACATCAATGATCTAGGTGTGTTCATCATGA
CACTGTAGGTTGGAGACGACTAGAACCTCGAAACTAATGCCCTTTCTTATAGAGGCCGAAGGCATTGAGATCAAGCTAGC
TCCGGAGACACAGAAGACGGGATGGTAAGTTCTACGTCAGACTACCTGCTTGTCGTTATGAAGCAAAGGCTGACGGTCCA
GGAAAATAAACTCATCAACGGCCACCGTTGAGGACAAGGAGATCCTCAAGAAGTACCTGACGACCCCACCAGTAAAGAAG
ATTGACCTACACTTCCCATTGGGACTGGAGGTTACTGCACGGAACATGCGGGGTGTGACCATCAAGGATGCATTGGACGC
GATTCACAAAGCATTCAAGAAGAGGGTGAGTCATCCTACAATAGACGGAAGTACGGGATAGATCGACAAGACTGACACTC
GCTACAGGCCGACGATGAGCTGGACAACCCATACCTAAAGGGCTTCGAGTGGGATAAGGAGGAGAGCTGGACTCGGCTGG
TTGTTCACCTGCAAAAGCAAAGCACCATCACCAGCGGCCCGTCAAAGAAGAAGAAGAAGAACCACGGCGACGACGAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62