GenePrediction:GLEAN_567 Details

Name: GLEAN_567
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:658700..661115 (+ strand)
Length: 2416
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:658700..658746 (+ strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_97:658916..658932 (+ strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_97:659095..659258 (+ strand)
Length: 164
Type: CDS
Source: GLEAN
Position: GCSC_97:659367..660509 (+ strand)
Length: 1143
Type: CDS
Source: GLEAN
Position: GCSC_97:660570..661022 (+ strand)
Length: 453
Type: CDS
Source: GLEAN
Position: GCSC_97:661092..661115 (+ strand)
Length: 24
>GLEAN_567 class=GenePrediction position=GCSC_97:658700..661115 (+ strand)
ATGAAGGAGTTTCTCGATTCGGACAGAGTCAATTTCCTCGTTTGGAGGTTTGTCTCCCGTCCCCCGTTCCCCGTCCCCAG
TCCCCCGTCGCCGCATTTTTGATCGCCCCTCGTGCCACCCAACCGCGCTTAGCACAGACCGCATCTCATCTCGGCTGCCT
TTGTTGTGGTTTCCCTTTATTGTCGGCGTGGCTGTTTGACTAACCATCTTAAACAGGTATCTTTTGGAAGGGAGTACGTA
AACTGTCGTAGACCGGCCCCATTCCCTCCCGTCTCGTTGTTTATCTGCTACTTTATCTATTATTTGATCATTTCCCATTA
TCTTACTGCTCCATTTTTCACAAAGCACCAAATCCCATACATCTTCATTCGCAACTCACAAACTAACATCATCAGACTAC
CGCGAGACAGCAGTCAAATTCCAAAAAGAATGGCACGTCAGGGAGCCTCACCGGCACTTTGATTTCGCACCCCATGTTAA
GAGTCATGCACTCGTTTCTGTAGTCAACCGGGGCTTGCTCTATTATTCTCTCGAACGAGAATACTTAAACTCTAAAACAG
TACGTTACTCCTTTGAAGTTTTCTTTGTTTTGATGCCTGTCGCGTTTTCCCCCTTCTCTTTCTGCATATGTTGCTTTCGC
CAAGTATGCACCTCTCACAACGCACAGGCATCTAAAGACGAGACCCAGCAGTTTGGGGTATTTGGGCCGCTCATCACAGA
ACCTCCAGTGCGCCATGTGGATCAAGACGAAGACGCGGAGGCAAAGGCCGTGACAACAGTGACGGGAGCCGATGATGCGG
AAGGCTTGCGCAAACGCCAGCTGGACAAGCAACAGCTGCAGCAAAACGGGGCGCCAGCGAAACGAACCAAGATCGGAAAT
GGGCACGATGCTGCCGGCGTTGCTGATGTCGCACCGCCAACTCCAATGGAGATCGATAGCAGCGAAAACCAACACGCTTA
CCCGTCACCTATGGAACGAGAACCCGCTCCGACGCCGGGACCACGAACCGATGGTCCTGAGCAGGGTACGCAGATCGATA
AAGTTCAGGAGCTGGCGCCGGAAACAATTTTCCTGCGCCTGGCACCCGATCAAGCCACGGGCGACGACCTGACCGAGCCG
CTGCAGCCGGGACGCGAGAACCCCATCGTCCTGCATTGTGAGTGGAACCCTGCCAACCCGTCCATATTGGCGGCTTCTGG
GTCAGATGCACTAGCCCGGATTTGGACACTTTCGCGTACTTCTGCCGATCCCGTGGATGATCACGTGAATGGAAGCAACC
GTCCTTACAAAGACCTGGTCGACGAGGATGTGCCTCAGACATCGACTGTAACCACCATGGCCTGGAACCCCGATGGGACT
GCGGTAGCGATTGCGACAGAAACTGGTACAAAGGCCAGCGTCAGTATCTGGGCTCCTGATGGCACCGTCCTTATGCGGTT
CAGTGCACAAGAGGCCCCAATGATCAAGCTGCGGTGGAATTTAAATGGCACTTCGCTTCTCGGGGTCGGCCCCTACAACA
GCGGGTTACTTATTACAATCTATTCAGCTGTCACATCGAACTCCACCTCTCATTTCCTCCCCGACTTTCCCTCCGAACAT
GACGCGCAACCGGATCTTGATGCGGCTTGGGTGAACGAAACCGAGTTTTTGGTGTGTGGAGGCGACCTGCTCCTCGCATT
ACGATGCAGTGAATCAGGCATTGAAAAGGCCAAGACGTTTGCAACAACAAAGGATGATAGTTTTGTACAGATCCAATACG
ATTGGAGAAGCAAGATTGCCGCCACAGCTAGCGAGAAAGGCCTGCTTGATGTAAGGATCCATGGAGGCGTCGAGAATAAG
CTTACCAGCAACCTGGAATTAAACTAACAGTCTCAGCTCTGGAACGAGGCTGGCGAGCGCCGCACAATATCCGCCCACAT
CGGTCTCATCACTTGCCTTATGTGGCAACCGTTACAGTCGACGCCACCGGCAGAAGAACGGTTGTTAGCCTCTGGGGGCG
AAGACGGTGCCATCTCTATTTGGAATGCACGGCTGCCTGACAGTAAGCCCAAGTGCTCGATGACAATGGACCTACCCGTA
GTAGCTCTCGCCTTCACCCCAGACGGTGCATTTATCGCGGGGGCCACAGCAGACCGCATCTTGATCTGGAAGGTTGGCGA
CCATGCAATCCCACGGGCCAGCTGGAGTAGAACTCCTCACCCAGGATGGCTCAGTCCCAAGACCAACGGCGACGGGGAGA
ACAGTGATGGCGTGGATGAAGACATTCACTGTTTATGCTGGGACACAACAGGTCAAAAGCTGGCCTATGGTGTAAAAAAT
AGGGTAAGTGTCAGAAATTTCGCCGTTACTTAAAAATTATGCGTGTTGAACTGTGCTAACTGATACGTACAGCTGGCCGT
GATCAATTTCCGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62