GenePrediction:GLEAN_5683 Details

Name: GLEAN_5683
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1634923..1629707 (- strand)
Length: 5217
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1634923..1634867 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_173:1634700..1634660 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_173:1634592..1634577 (- strand)
Length: 16
Type: CDS
Source: GLEAN
Position: GCSC_173:1634512..1634447 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_173:1634364..1634269 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_173:1634099..1633993 (- strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_173:1633907..1633821 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_173:1633057..1632625 (- strand)
Length: 433
Type: CDS
Source: GLEAN
Position: GCSC_173:1632405..1632389 (- strand)
Length: 17
Type: CDS
Source: GLEAN
Position: GCSC_173:1632281..1630955 (- strand)
Length: 1327
Type: CDS
Source: GLEAN
Position: GCSC_173:1630888..1629707 (- strand)
Length: 1182
>GLEAN_5683 class=GenePrediction position=GCSC_173:1634923..1629707 (- strand)
ATGCCGAGGCAGCCGCCAGACATCGCCGAGGGCCGGAAAGCCGTCTGCAACGTCACCGTACGCATGCATCGCGGCTGTTC
TCTTCCTTTTTATTTCCCCCTCCGCTCGGCAATTGATTTGAAATGGCGACAAGGAAGCTGACCCCGACCAGATTTGTGCG
GGCAGTGAGTAGACACAGGTAGCACCGAAAATCAAAGTGTCTTTGTTAATCGCAGTCGCACAGGTGCTAAAAGACTTTAT
GAAGGAGTCTGGTCTGGAGCCTCAGTGCGTAGTCTCTTGAATGCGTTCTGCCCCATTGACCTGCATGCTAACGGCATTTC
GGCGCGGCTAGGCTGTTTGGGTCCCATGTTAGTGGTCATGTACACCTCGTCCGAAGCCGGGCAGCCTCAATGACTGACAT
TGGCGGACCAGCTCCGGGTTTTGCATGCCTCACCGGGAAAGGTTGACTTTGAGCTGGACATCAAACAGCAGCACACGGTA
CGGCCAGCTCAGCTTGCTACTGACTGTAATCTTGCCTCTGCGAGCGTGCACAACTGACTGCTTTGTCCACAACCAAAAGA
ACCGGCTAAAGATCATCCACGGCGGCACCATCGCCAGCATGGTCGACCTAGCCGGATCGCTGGCCGTTGCATCCCACGGC
CTATTTGCCACCGGCGTATCCACCGACCTGAACGGCAAGCACTCTGAACCTCTCTGATCTGTAGTCACGGCGCTCTGCAT
CGTTAACACAGAACAGTCACGTATCTCGCCGGTGGCGGCATAGTTGGCGACACGCTTAAAGGAAGCGCTATCTGTGATAG
AAGTGAGGACTTCGTTGTTGCTAGTCCTGTGCTACGCTGACAGCAGCTGCAGTTGGAAAAACGCTCGCCTACACCTCCAT
AACCTTTCACAACCAAAAGGGAGAGCTCGCTGCTCGCGGCAGCCATACGAAGTAAGCCTGATTTTGACTCTTTATTGATG
CTTGTCTGCCCCTACCGTAATGCCGTCTCTAATACAGGCTACCTAAACGCACATAGATTCATCGCCAAGGCCTGGGGCAA
AAACGAGCCCTACACAACTGACCGTGCATTGGACGAGGACGACGAAGATGCTGCCAAAGGCGAGTGAAGATAGACAAGAG
AATTCAAATCAGCTTGGGGCACATTATGCGGCAAAGTATGTGTGCTTTAGATGTAACTCCACGCATTTCATTCGAATAGA
CGGTAGGCTGCCTCGCGTCGAATTCATTCTTCTCACTGCACGTGCCACCGCTCAATGCATTATTGCTGTGTTTGATGGGT
GAGTGGTACGACCTGGAGGTTTTCCTGTAAAAAAACAGGGCATTTTAATTTCACGATACATTAACAGTAGACCAGAGGCA
TTCTGTTGCGAATTAATAAGCATTGAATAGTTTTGCAAACGTAGGAACGTACTTACGTTGGGAATACACAAAGAAACAAG
AGAGGAACCATAATTTCAGCGGAAATCACCGAAAGCAAGGGCGCTAAGAGAGGAGCCAACTTATTTAGAAGAGGAAATGA
CTAGCACAGAGAGGTACGGTGCGTTGTGTACGGAATACTGTAAAGTAATAGGTTTGAGAAGAAATAGGAATTAGTAAAGC
TTAGCGGGAACGCCAAACTCTCTAGGCCGCTGTACGCAGTCTGATAGGGATGAGCCCTTCAAGGCTGTCGTGGCAGGTGC
TATAAAATTTAATACACACCACGCCTCTATTTTCACAAGACTGGTTTCTGTCTTCGCCTGGTCTCAATTAACTGATGCGC
CACCAAGTGAGTGGTATACTTGGACGATATGTCCGGTTCCCTTGGCACGGGCTGCCATCTTGCGAAGTAGATTATCACGC
AGCAATCCACGTGACGAACGTCTTAGGCGCCTTCCCAATGCGGCGCTCATGGGCGGGTCAGCCGTCCCTGCCCCCATTGC
CATCGCCGGCGTCCGCCCCAAAACACCCAAATCAACATTTGGCAAGCAGACGCTTCTCGATGGGCGCGTCGCCGCGATGG
ACCAGCTCGAATCCCAGGCGTCCGACCTGCGCTATCTGAGTGAGGCTCCGACTGCCTCCATGGCAGACGGACTGTCGACC
CAGTCAGAATGGCCAAACGCCGACACGTCCCCACGTCAGCTAGATGCCGGTTTTGCCAGGCCAGCGGGTTCCGCACCAGC
CGGAGGCAATTCCGCGTTCCCATCCACACGACTGTCCCCCTTCTCACCTGATGACCAGGATGGCAGCAGCAGCACGCCCA
AGCGGAAGCCGGACCCAAACGATCTGGGCCCGAAGCAGCAGAGGAGCAAGCGCAATCGGGTGAGTTGGACCGGTCTCTCT
CTGTCGTCCCACTCTTCTTTTGGCCGCGGAATTTGGTCGTATTTCCTTCTTCATTTCACGGCGTACCTTTTTTACTTTTT
GCATTTGTACCTTCGTCCACTTCCCACCCACATTGCCATTAGCCCCATGTCCATCGGTTCCGCCCTGTTCCGCTCTGGGC
AGATCCAATCGTGCTAACAGGTCTGATCCCCGGTCTAGTACATCTCTATTGCCTGGTAAGACAAGCCAAGCCCCTGTTCC
TCTTCCAAGCCCTGAGACCCAGGGTGGGCCATGTCGGTTGATGCCGTCTTGGACCAAGACTGACGCTCCCACTCCTATAC
AGCAACGAGTGTAAGCGGCGGAAGATAAAATGTATGGACCCCCGTTCTGTCCCCTCCCTCTCCCCCTTCCGTGCCACCCT
GCCTGTCCAGACTAATTCTGTAGGCAATGGCGAGGCCCCGTGTCAGCGATGCGGCAACCTTAGTCTGGCCTGTCTGTACT
CGGCAAACTGCTGTTCCAACAACTTCAGGGAGTCGGACGAGTACAGACAGATGACCGACAAGGTTCGCTTTCTTGAAGGC
CAAGTAGGAACGCTCTTTCAGAATGTCGATGTCCTTCGCCTGGAGACTCAGCGGTTGGCTCCGCTGCACGACCGCATCCT
GCCCATGCCAACATCGACCGTGTCACCGTCGCCATCGACCTCTATCCTGTCTCTGACCAAGCCGGATCTTGCGCCCCTCC
GGCCGCCGCCCATCTATCGAGGGCCGACCAGCAGTGCTTTCACCGTCGACGTTGCCAAAAACACGCTGCATAATATGGGT
TACAGCGGTGAGACCTCCGAAGACCATGGCCATGCGGATGGGACGTCCCGCTCGTCGACGGCCGTACCCTCAGGTTCGCA
TTCGCATTTGCAGCACCAGCAGCAGCAGCAGCAACATCAACACCAACAGGCGTATCAACACCAACGCTATCATCCGCTGC
TGCAGCAGCACCAACAGCATCAGCATGAACAAAGCCATCAACAGCAGCAACAACAGCAGGCACAGCTTCCGACGGACCCG
CTCTGGGAGCTTGATAGAGACGAGATGGTGCGGCTGTGCCGAGTGCATGAGGACGAGGTCGGTGTCATGTACCCAGTGGT
GAAGATTGAGACGGTCATTGCCCATGCGCACAGTCTGTGGTCGTGGATGGAGGCATCCCGCAAGAACGGATACATGCAGC
AGCCGGAGAACTACGAGGACACGATGCAAAGCGTGCCGACACTGTTGCTCAAGATCATCATGTGCAGCGCACTGGCCGTC
GAGGAGCACGGCCACAGCGAACGGGCCATCCGCCTGTACGACAGCATGCAGACCATCATCAACCGCAAGCTGATGAGCGA
CCCCAGCGAGATCGGCAACCTGCCGCTGCTGGCTCTGGTTGCCGGCTACCGCTTCCTGGCCAACGACGAGGTGCTGGCCT
GGCGCATTATGGGCCAGGTTGCCCGCCACTGTCTGGAGCAGGGCCTGCACCGGCGCGACGGCCTTGCCAAGATTGTCGAC
GAGCAGGACCGCAAGAACGCCATCAACACGTTCTGGTCCGCCTACGTTCTAGACCGCCGCTGGAGCTTTGGCACGGGCCT
GCCTTTCGTCGTGCACGACGACAAAATTGACCCCGAGCTTCCCTTTCCTGTATGCAATTTGTCCCTCTCTAGACCAGCCG
TTCCCGTCTGCGTGTGCTAACAAGACGCTCTGTAGGACCAATATCCGTACCTGGTGGCCATGATCACCTACTCGCGACTC
GGGGCCAAGATCTGGAAGCTCGTTGACTTCTTCGAGCCCGCCATTGTCCGTGACCTGCAGCGAAACGAGGTCGACGCGCT
CGATGATGAGATTCTCCAGTGGTACGACAGCGTGCCGGCGGAGGTCAGGATCAGCGCCTTTGACCGAGACCTGCCACTGC
CGTCGACGCCGTCATACAACCTGCAGCGGCTGCAGATTTGGACGCGGCTGCGGCTCAACCAGATCCGCATCTGGTTGCAC
ACGCCGGTTCTGCATAGCGCCAGCAGCATCACCGCCAACATGGAGCTGGCCCAGAAGGCTGTCGACCTGGCCAAGGAGAC
CATCCGACACCTGTCGCGCCTTAATGACAGCAGCAACCTGTACCGCCGCCTTCAGGTGTTCTACCACCAGTTCTTGACCT
CGGCCATTGCCGTGCTCTTCCTTGCGTCCACCCATCAGCCGGTCGTGTTCAGCGGCCAGTGTCGCGGGGAATTTTATATG
GCCCTCAACCTCATCAAGGACATGTCGGCTAAAAGTTGGGTTTCCCAGCGCCTCTGGCGTACCGTCAGCTCACTCAAGGC
TTATGCGCCGCGCGTCGGCCTTGGCCTCGAGCAGATGGACGAGGAGTCGCAGCTTTCGGGTCGTGGAAGCAGCAGCGACA
ACAACTATCCCTACCACCATTCTCAACACCACTATCATCCCCACCCCCATGCCCATCATGCCTTCTTGGCAAGCAGCGGC
AGCGGTGGTGACGGCACTCCATCGTCGAGCTCGTCTCCATACGAACAGCAGAGCGTGCAGAGCAATCAGAACGTGCACGG
CACTCACGGAAACGTCCGGATTGGCGCCTCTGGTGGCCAGTGGACACTCCCGCCACCACCGCCACAGCCACTGTTGTCCT
CCTCCTCCCCGTCTTTGTACGGTCGCCCACAGCTGCTACCACCGCCGCCGCCAAGCAGTGCCGGATCGCCGGCGCAGAGC
CAACCCCCCGGCCAGAATGGCAGCTCCAACGGCTTGCAGTTGCAGACCGAAATGTCGCGCATGTTTGAGGGCTACATGGG
CATGAGCGGTATTCCCCACCCACCCGCAGGCCTGGTTGACAGTAGTCCCAGCCCGTCCGGTGAGGCCCTGTATGAACACA
TGAAAAACATGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62