GenePrediction:GLEAN_5684 Details

Name: GLEAN_5684
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1628175..1626219 (- strand)
Length: 1957
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1628175..1627585 (- strand)
Length: 591
Type: CDS
Source: GLEAN
Position: GCSC_173:1627527..1627348 (- strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_173:1627289..1626219 (- strand)
Length: 1071
>GLEAN_5684 class=GenePrediction position=GCSC_173:1628175..1626219 (- strand)
ATGAGTCAGCTGGCACCGCGCCTCACCAACTATGCCGCCTACGTCGACCCTGACACAGGCCGGCCGCGCATCGGCCACCT
CGACCTGGCCACACGGGCTGTTCAGCCACTGAGCTTTATCTCCGGCACTCCCGTTGGTGACCTGTACCAGGTTATCGCGA
CCAGTGCCGAGAGCATTGTGGCAGCCGGACGACCGCTTGCGTCTGCCACGATCCTGCCGCCCATCTCCGGGCGCGACGTC
CTCGCCGTGGGTAAGAACTACATGGAGCACGCCAGGGAGTTCAACAGCTCGGGCTTCGACAGCTCCGACAAGGTCGATCG
GCCCAGCCACCCGGTGATCTTTACCAAGCGGGCGACATCGATCGTGGCGGACGGCGCGGAGATTGAGCCGCATGGGAACT
TCACGACCACGCTCGACTACGAGGGCGAGCTCGGTGTCATCGTCGGACGGGCAGGTCTGCACATCGCCCTTGAGGACGCC
TGGGACTACGTTTGGGGCTACACCATCATCAACGATGTGACGGCGCGCGAGCGGCAGCGTGATCATAAGCAGTTCTTTCT
CGGCAAGTCAGCCGACACGTTCTGTCCAATGGTATGTTCGAAATGAATAGGTAGATGGGAGACAAGAGGTTGCTAATTGG
TCCAACAGGGTCCCATTGCCGTCCCTAAAGAGGATCTCGCTGCCACGCTACGCGTACAGACTCATGTCAACGGCGAGCTG
CGCCAGAACGCGACTACCGACGATCTGATCTTTTCCATTCCAGAATTGATTAGCACGCTTTCGTCTGGTATGACCCTGCA
GCCAGGCGACGTGCTGGCCACAGGAACGGTAAGCCAGTCCATTCTGTGGTCTCACTGCTCCGGTTGTACCCCTTCTAAAC
AGCCAGCCTGCTGGTGTCGGCCTCGGCCTCAAACCTCCCGTATACTTGCAACCCGGAGATGAGATCTCCGTGTCCATCGA
TGGTCTCGGGACGCTGCGCAATAAAGTCGCCCAGCCGCAGATCAATGGTGCCAAGACCACATCGCGTGTGCCCCCAGCCG
ACGCCTTTCCCCTGACCAACGCTAATCGGTCCCTTGGTGGTACCATCGGCCTCACCAGGATCAACGGAAAGCCTCTACAC
TACCAGCATCGTGGCAGCATAGGCACAGGTGTTGCTGATGGTGATCAGAAGCCCATTATCATCTTTGTACACGGCCTCGG
TGGTACCCTCGATGTGTGGACACCTATCATCGACACGCTGGGGTTAGATGAGTCCTCACCGAGCAGAATTGGCCAGACAT
CAGCATCCTTGCACCTGTTTGACCTCGAGGGCCACGGCCTCAGTCCGACTCATCCCCTTCGGCCTGTCACCATCGCCTCA
TTGGCGGCCGACATTGCTGGTGTTTTTTCCGAGGCGGGTGTGTCGCCTACCCGCCCTGCCGTCATCGTTGCTCATTCGCT
GGGCTGTCTCGCCGCCGTCCGCTTCGCCCTCGATCACCCGGACCACCAGGCTTCCATAAAGAAGCTGGTCCTGCTGGGCC
CGCCGTCGTCACCTCTGCCCGCCTTCTCCGCTGCTGGCTTGCGCACGCGTGCTGCCCTGGTGCGCCGTCAAGGCATGGGC
TCCATAGTCGATGCTGCCGTGTCAGCGACAATATCGACCCACACGCACACGAAAAATCCTTTGGCTGTCGCTGCAGTCCG
TCTCAGCCTGCTCACCCAGGATCCAGAAGCGTACGCCAAGGTATGCCAGGCGCTTGCCGCTTCTGAAGCCGATGCGCTGC
CTTTGGAAGACCTGCAGGTGCCGACACTTGTCGTAACTGGCCAAGAAGACGAGGTATCACCGCCGGACGTGGCCAAACAG
TACGCCGAACGTCTCCCTCACGGCCGACATGTGGTTCTGCCGCAAACAGGCCACTGGTCCATGTACGAAAACATTGAAGG
CGTGGCACAAGCCGTCAAGGCGTTCGTCCTGTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62