GenePrediction:GLEAN_5685 Details

Name: GLEAN_5685
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1623844..1622013 (- strand)
Length: 1832
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1623844..1623678 (- strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_173:1623624..1623543 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_173:1623482..1623206 (- strand)
Length: 277
Type: CDS
Source: GLEAN
Position: GCSC_173:1623139..1622785 (- strand)
Length: 355
Type: CDS
Source: GLEAN
Position: GCSC_173:1622700..1622644 (- strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_173:1622526..1622379 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_173:1622321..1622013 (- strand)
Length: 309
>GLEAN_5685 class=GenePrediction position=GCSC_173:1623844..1622013 (- strand)
ATGGCTGCTTCCGACCCCTACAACGTGTCCAAGGCACCAGATGCGACCGTCGTGTCCTCTGATGGCGAGCGGTCTGTAGA
GAGTAGGTCGACCAGCTGGCTTTTCTTCTGGAAAGGGCCAAGGTCTGCCGAGCAGAAACTCCTTTTCAAGCTGGACATTT
TTATCATGTAAGTCGAGTCGTGGCCTAGAACAGCAGGTCTTGGCACTACTAACATGTCAGGACATGGGCGTGTTACGGAT
ACTTTATCCGTCTGCTGGATACGAGCAACATGACAAATGCATATGTTTCGGGCATGAAAGAGGTAGGAGCTATTTCGATG
CGACCAATGGCAAAGAATGACGTGCTAATACGCACGTGGCAGGATCTAAATATCCACAAAGACGAGTACAACTACTTTAA
CACTTTCTGGACTATCGGCTACATTGTCGGCATGATCCCCTCGCAGATCATCATTACTAGGACCCGGCCGTCCTACTGGC
TGCCGGCGGCTGAGGTGGTCTGGGCCATCATCACCTTTTGTTTTGCTGCCGTTAAGACGGTGAAGCAGGTCTATGCCATG
CGCTTCCTGATCGGCCTTTTCGAGTCTCCTTTTTACGTCGGCGCCATGACGCTGCTGGGAAATTGGTACACGCCCAAAGG
TGAGAACGAGGCTGCCCCATCAAGTCTCTAAGCAGCAATCCTTTGCTGATGGGTGTATCGAACAGAGCTGGCAACACGTG
CTGGCATCTTCTACTCAGCCTCATTTGCCGCCAACATGTTCTCCGGCTACCTGCAGGCCGGCGTCTATCACGGTCTCAAC
GGCCACGGCGGCCTGGCCGGGTGGCGCTGGTTGTTTATTCTGTGTGGAGTCATTACGTGTCCCGGGGCGATATGGGGCTT
CTTTGTAGTTCCCGACAGCCCGTACTCGACAAAGGTGTTTTATCTGTCCAAGGAGCAGGTGGCGCTGGCTAAAGAGCGCA
TGGTCAAACTGGACCGCACCGGGTTCGAGGGCATCAACTTGAAGACATTTAAAAGCATCCTGATGAAGCTGTTTGTCTGG
GTCTTTGTGATCAACTACATGTAAGCTGCCGCTTCTTGCCTCGCGTCTTTCCGCTGCAGTATCTGACCGGACAGCTTTTT
CTGCATGGATACCTATTCGCTCAGCTTCTTCGCCATCTACCTCAAGTCCCTAAAGCGGTTTAGTGTGGAGCAAATCAACA
CGTGAGTGTTTCTTCGTCCACGTCGGCTCTTTCCTCTTTCTGACAGCTCTAGCATCCCCACTGCGTCTTACGGCTTCGGC
TTCTTGTCTACTATCTTTTTTGGCTACATCTCCGACAGGTTGCGAAACCGGACTGGCGTCGCCTTCGTCGTCACGCTTCT
AAATGTTATCGCTTGCTCGGTCCTTGCCGCCCATCCTCACACAGCTGGCGCCTTTGTGGGATATATCCTTATGGCAGGCA
CATTTGTCTACGGCCCGCTTATGATTGTGAGTATTGCTGGAATTTTCTGGTTTCACGGTGGCCAGACTGCTAACCTGACG
CAGTCCTATCTGGCCGAGACCTTTTCGAGCTTGGCCGACGAGCGTGCCTTGATCCTGGGTATCGCACAGACGCTGGGAGC
AACCTTCACTGCCTGGCTGCCGCTTCAGATATTCAATACCGGAACACAGGGGCCGTTGTTCCACAAAGGATATCTCACCG
TCAGCATTATGTCGGGCTGCCAGGCTATCGGTGTTCTGCTGATGTGGTACTTGGGGAGCAAAATTACAAGGGAGTCCAGG
GAGGCCGCAGATCGACAGGCTGATCTGTCACCGGTAGAAGAGAAGGGAGAGGGAAGGGAAAGTTTTGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62