GenePrediction:GLEAN_5687 Details

Name: GLEAN_5687
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1608513..1606324 (- strand)
Length: 2190
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1608513..1608355 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_173:1608099..1608081 (- strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_173:1607696..1606324 (- strand)
Length: 1373
>GLEAN_5687 class=GenePrediction position=GCSC_173:1608513..1606324 (- strand)
ATGTCGGCCACGAGCAGGCTGGTCGGGCAATTTGGCAACATGTCAAAAGCTACCGATGAAGCCGGCCTCGGGCATGTGCA
CAATCTCTTGGATGGAGATGTCGCCAATGCAAGCACCTCGGCTGGGCCGCAAAATAAGCTCCAGCATGTCGAAAGTGCCG
TCGATCCCCACGCCGAACGAGCTCTGGTTCTCACCCATGAATGCGAAAACATCCGGCTATGTTTCAAAATTCCAGTGACG
GCATTGATCTGATCGAACGTGTGGACGAGGCAAACGTGGGGTTGTCGGGTACAACGTTAGTCAGCACGTATATGGACGCA
TTTTGGCCAGACTGTCGTCACCAAGAAGTCGCCACTAGACCGGACGTAGAGACGGGACTATTTCTTGTGCCTCGAACGTA
AACTACAATGACAGGTGCTTGAACACTGTGCGGGTACGTTAACTAGGCTAAATGCCGGTTATAAACGTTGTCTGTTTCTT
AGGCCTTCTTTTGTGGTCGACATGCGTCTTCTACCGGAAGCTCCTACCGGACTGCCTACTTTGAGGGTAATCAGAGTTGC
TATCCCTTCAACTCCACCGGGATTGCCTGCCAAGCTGCATGAAACGGGTAAATGGGTAAATGACACAGAGCCATCGCGGA
GAACATCAGACGTTTTCTGCACCCCGCACAACTCCGCAATTCATGGAGACATACGACGGGCCGTAAGGTTGGCTTAGTAT
ATGATATGGCTATGGTGGACTGACAGACGTGAGTTATGGAAAGCCAGCCAAACAATAACTATCGTCATGCATTCCATTTT
TTTGTTTCTTCTCCAAGGTACTGCAGCCGCCGTTCTTCCAGGGACGCTCGAGCGGCGGACGACAGTCTCGGGAACGGCCG
TGGTAGATCTTGGCGTGTCGACTGGGGCACCACAGCAGCTGGCGTCGGGGGTTCTGTACGGGATCCCGGACGAGGCAAGC
CAGATACCCGACCATTTCTACACCGACATTGGCTTCAAGTATTGCCGCGCTGGTGGCGCACAGCTACCAGGCCAAGGATG
GAGCGAGTCCGAGGCGGCGTACGAGACGCGGTTCCAGTCGGCGCTCAGCAACTACCAGACGACGCGCAAGTACGGCGGCA
CGTTTATCCTGCTGCCGCACGATATCTGGGGCGCGGACGGGACGCAGGACTCGTCGTTTGTGTACCCCGGGGACGACGGA
GACTGGAGCAGCTACGACCAGTTCCTGGCCCGTCTGATTAGTGACCTCCGGGCCAACGACATGCTGGATGGCCTCGTAAT
CGATATCTGGAATGAGCCAGACCTGACGGGCTTCTGGAACCGGTCGCAGGCGCAGTATCTAGACCTATGGGGGAGAGCGA
GCACAGCCTTTCGGGCGGGGCTGCCGAGCTGCACGATCTCGGGCCCCTCGTTTGCAGGATCACCCAGCACGACCAACTCG
TGGTGGACGGCCTGGACGGCCTTTGTGGCCAGCAACGGCAGCGCACCGGGACAGTACAGCTGGCACATGGAGGGCGGTGG
GGGAGACATGCAGTCGTCCGTGGCGGCCTACAAAAGCCTGCTCGTCGGCCAGGGCCTGGCGACCGATCGGACGGTCAACA
TCAACGAGTACGCCGTCTGGGGTGAAGAAGTGGCAGCCGGCAGCGCCTGGTGGATCGCACAGCTGGAACGCGTCAATGCC
TATGGGCTGCGCGGCAACTGGCTCTCGGCCTATGCGCTGCACGACCTCCTGGCCAGCCTCGTGTCCAAGCCGGGTGCCGG
CACGTCTGGATACAGCTACACCCAGACAGGCTACTATCCCACCGCCCAGTGGCTCGTGTACCGTTACTATGCCCAGGACA
TGGGCCAAGGCTCGCGGCGCCAAACCACGCCGACCGATGACCTGCTGGGCGACGTCTTTGCCGTCGTCGGCGAGGACCAC
ACCGTGCGCATCCTCATCGGTGCACGCGTGGCCTCGGGAACCTTCAACGTCGAGATCCGCAACCTCTCGGCCATCGGCCT
GGCCACGGCCGGCTCGCTGCGCGTGCACGCAATCGGCTTCACCAGCTCGACCGACCACTATGCCGAGCTGGACGCGCCGG
CTGATCTCGGCTATGTTAGCCATTCATACAGCGGCGACTCGCTAACCCTGCCGGTCTTCCAGACTGACGACAACACAGCG
TACGCGTACGAGTTCAACACGACGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62