GenePrediction:GLEAN_5689 Details

Name: GLEAN_5689
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1595740..1593487 (- strand)
Length: 2254
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1595740..1594999 (- strand)
Length: 742
Type: CDS
Source: GLEAN
Position: GCSC_173:1594934..1593487 (- strand)
Length: 1448
>GLEAN_5689 class=GenePrediction position=GCSC_173:1595740..1593487 (- strand)
ATGTCGCCAACACTTGAAGACCTGCTGCGCCGGATTGCGGAATTGGAGGGGCGTGCAGAGAAGGACAAGCAGCAAATGCA
AACTCTCCAGCAGCGCACGGAACCATCACTCTTCCTCGACTACCTGCGCAGCACTGAGGAGAACCTTTTCGCGACATTCC
GACCCCCAGTGCCATCTACGACCACGACCAAAACATCGAGCCAGACGACGTGCGTTAATGGAAAATTCTACCCGCGCCGA
CTGCGGCCGTGGACAGAATTTGAAGACGCCCACACCGCTCAGTTCAGGACGCTGACCGATGCTCTGGAAGACCACGCCGT
CTTCCCGGCGCTGACCGACGTTTTGGGCGCCAGCCGCGACCTTAGTCCTACACCCAACGGCGAGATGGACCTGCGCCCGT
TTGTCAGGGCGTCCATCGAAAAGCCAGCCGTGCGGATCATCAACGCGTACATGAGCCTTGCGGACAACCCGCCCTTTACA
AGCATCAACTTCCAAAACAACTCGTACGGCCTCAACCTTGCCGACACGCCGGACGATGAGCTGCAAGAGGTCCAGGGACC
TGCGGCAAAACGCCAGCGGTCGCCAGTAAAGCGCATCGGCATTCCGGACCGCTGGTGTGTGGGTGTACTGCAAGACGGGA
GCTGTGCGCACGTGCTCGTGGGAGAGTACAAGGCCGCACACAAACTGCCTGCCAGGAAGCTGAAGGCTGTTCTGTCGACG
GCGCCGGGCGAAGACTTTTTTCGTCCAGGCTGTGAAGAACAAACGCATCGAGCCATTGCTTACCGCAACGTCTGACATGA
AGTCAGGGGCGAAATCAGACGCGACCGGCTCTCAGCGTAAGGCTGTGCCAGGGGATGCGTTCGTTGCCCGCGTCCTCTGT
CAGGCTTACCACTATATGATCACCTCAGGCCTCGAGTTTGGATACGTGGCATCGGGCGATGGCCTGGTGTTTCTACGTGT
CCTCAATGATGATCCCCAGACGCTATACTACTCGTGCTTTGTCTTTCCCATCCCGCTTCCCCCGAGCAACGGGCCCGAGT
CCGACAGAGGACACCAGAACACTATCAACATTAACAGACGCGAGCCGCGAAAGACAGCAGCAGCCTATCTTGCTAGCTTG
TGCATGCTTGCCCTCCAGTCAAGTCCGCGCCCAAAGAGCTGGATTGATGCACGCGATCACGACCTTGCGCGATGGCCTGA
TCCGTATGGTGGAATTGTACCCTTGTCAGAGATGTCCCTACCGCCACCACCACCACCACCAGATGCCGGCACAGACGGTG
GGAGTGCTGGCGGCTCGGGCAATAGTTCCGGAAACGCCAGCAACAGCGGCCTCAACACGGCGAGTCTGCCCAAGCGGCGA
CGGTCTGATTCGAACCACACACAAAATACGTCTCAGCACGGATATACGGCGCGTACACACTTTGTTGTCGAACCTCCAAC
GCTGCCTTACTGCACCCAGGCCTGCCTCCGTGGTCTCTGCAACGGCGCGCCACTGGATGACCGCTGCCCCAACGTGGCTC
TGCACCGCGCCGCCTGGCTGTCGTCGCCAAAACGCCGCTGTCGCCACCTGCTCACAGCCTCTGATCTGCGTTCCCGCGTT
GTCGCCCAGCTGGCCGACAACATGGATAAGGATTGCGAGTGCCTCGATCGGTGGGGCTGCTTTGGTCGCTACGGCGTGCT
TTTCAAGATCGTCGTCACCGGTTACGGCTACACGCTCGTCGCCAAGGGCGTCCAAGCTGTGCACCGTCACATCGTGCAGC
ACGAGGCCGCCGTGTATGCAGCGCTGGCAGAACGAACCGGCCCGCAGCTCCAAGGTCGCCTGATTCCCGTGTTCCTGGGC
ATCGTCGGCCTCGAGCGGCCCCTGCCGCTGCACAGCTGCGCCCGTGTTCCGTACTTGATGTTGATGTCCTACGCTGGACC
GACGCTGGCGTCACACAAAACGCGGCAGGCGCTGCTGGATGCTGGCACAGACTGGGAGGCCGAACAAGATCGCACGCTGC
TGGAACTCGAAGCAGCCGGCCTGTACGATGAGGACGCGCGTCCAGCCAACTTGGCCTGGAATGCCGAGGCAGGCCGGGTC
ATGCGACTCGACTTTGGCCAGGCCTATGTGGAGTCGCTGCCGGTGCAGACTTCATCACCAGTCCTCGCCAAGCGAGACTT
GGATGCACACTGTGGCGCTGGCGACCACCACCAGCCAGCTCTCAAGCGGATGCGGACCGGCTCAGCAACTGTCGCCGACC
CTATGCATGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62