GenePrediction:GLEAN_568 Details

Name: GLEAN_568
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:663528..664092 (+ strand)
Length: 565
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:663528..663640 (+ strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_97:663721..663832 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_97:663901..664092 (+ strand)
Length: 192
>GLEAN_568 class=GenePrediction position=GCSC_97:663528..664092 (+ strand)
ATGATGGGTGGGATCCTTGCTAGGCAGGCGAATGAACAGGAGGACGAATTGCCGGATGATGATTTGCCATCTGCGGTGGG
CTACGGGCCGTACTGGGACGCCTTGGTGGAAGCGTAAGTTTTGGGCTCTGGTGACGATAGGAGATCCACGGGGACATACA
CGAGACATTCACTAACGTCTGTCGCTTCGAAAGGACCGTGGAGTTTGATCCCGAGAACTTTGAGCGGACAGATCCACGGC
GGCATGCAGCAGCCGTTCTTGACACACCGGAACTGCTGATGATGTATGCTCAGAGCATGGGAGATGTACGTTTGAGGATT
ACTAGGCCCTCCTGGTGAGCATATCTTTACTGACATGACTGCTTCTTTCACAGTCGATTCCCGCTACGCGTCTCAAGTTC
ATGCGCATGATGTGCGGCTACGATGAAGAGGCAGGAGAGCATTTGACGGGCGGCAGAAGCAATGAGCCAGTGCACAAGAG
GATCTGCGTGAGAAAGAGCAAGAGCAAGGACCAAGATGCGAACGGCAAATTCGCTCACAGACGGAGACGGCAGAACTACA
CATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62