GenePrediction:GLEAN_5690 Details

Name: GLEAN_5690
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1587262..1586167 (- strand)
Length: 1096
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1587262..1586293 (- strand)
Length: 970
Type: CDS
Source: GLEAN
Position: GCSC_173:1586240..1586167 (- strand)
Length: 74
>GLEAN_5690 class=GenePrediction position=GCSC_173:1587262..1586167 (- strand)
ATGCAACTCCTCTCCGGTCTTCTTGGCCTGGCCGCCGTCGCCTCGACCACGCTGGCCGCCGTGAGCAAGAGCAGCCCGCC
GGCGGCAAACGTGTCCGTGCTGACGACATTTTCCTTTCCCAGCTGGGCCGAGAACCTGGCCGTGCGCGCCAGCGGCGAGA
TCCTTGTCTCGCGTCTGGAGGCGCCCGCCGTCTACCAGATCGACCCGGCCACGGGCGCTGCCACGCTGGTTTATGCCTGG
GATGCAAGCGCGTACAAGGGCTGTCTGGGCATTGCCGAGATGACAACCGACGTATTTTACGTCATTACGTCTGCCTTTAT
CGACGACGACTTTGTTAAGCAGAGCGGGATCAACTCCATCTTCGAGGTGGACATGCGCGCCTTTGTCATCGGCAGCGACG
GTGTCGTCACGACCAACGCGACCGTCCGCAAGCTCGTCGACGTCCCCGAGGCCGACTTCCTCAACGGCATGGCCGTGCTG
GATGACAGCTACATCCTCGTATCGGACGTCTACGCTGGCGAGATCTACAAGATCGACACGGCCACGGCCAACTATAGCGT
CGTGATCAGCGACCCCCTGATGAAGTTTGACTACGCTTCCCACCCGCCGACCAACCTGGGCTCCAACGGGATCAAGATCC
ATGACGGCTGTCTCTACTGGACCAATACGGCCGCTGGCTTCCTCGCACGCATCGCCATCGACGCCGGCGCCAACCCGATC
GGCAGCTCTGCCATTGCCGTCACCGGTGTGCCCAAGGCTGACGACTTCTTCATCCGCAGCGACGGCGTCGCTTTCATCTG
CCAGAACCAGATGGACACCCTCAGCGTCGCCTACCTCGACAACTCCGCCTCCACTCCCGCATACGCTATTGCTGGCAGCA
ACACCTCCACCATCCTTGCGGGCGTCACCGCTGCCAAGTTTGGCCGCCGGTCTGTCGACGAGTCCACCCTCTACCTGTCG
ACCAGCGGTGGTAAGTTTCCTCTTCTGAATTATTGTGTCGTCCACTTTGTGTTAACGAACAGCCCTTGCTTTGGCCATCA
ATGGAAGCGTTGTCGTCGCTGGTACCATCTCATCCATCGACACCACATTGTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62