GenePrediction:GLEAN_5691 Details

Name: GLEAN_5691
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1581964..1580879 (- strand)
Length: 1086
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1581964..1581606 (- strand)
Length: 359
Type: CDS
Source: GLEAN
Position: GCSC_173:1581530..1580879 (- strand)
Length: 652
>GLEAN_5691 class=GenePrediction position=GCSC_173:1581964..1580879 (- strand)
ATGACGACCGCGTCTCGCACAAATCTCGGGCCTCTCACGACGACCTTTCGCCCGCCGTCATCCTGCTCGCTCGTCGGTCG
CGACTGTGCCACTTGCGACTATGGTTACCAGGCCCAGACGTGCAGCGATAATTCGGCCAACACGATCGGCATGCAGGACA
ATGCCAATTGCTGGCCGCCCCGGAGCAACCTCGACGTGGCCACGCCCGCCGCTCTGGTTGGCTGGGGCTTCTACTCGCCC
GGCCTGATCTGTCCTACTGGCTACCAGACTGCCTGCAGAGCCACCGGCAGCGTCGACGGCGGCTTCGGCTTCATGTTCTC
GCCTGCGCCGTCCGAGACTGCCATCGGCTGCTGTCCTACGTACGCTGATTCTCGAAATTCATCATTGTAGCTACGTACAC
ACAGGCCGATTGACTGACCGATTTCCCTCTGTAGTGGCTACACGTGCCGTTTCGATCGTTCCTATGAGGTCGCCCAAACC
TGCGTTAGCATTGCCACGGCAAGCTCCTTTCCCACACTTCAATGCTCCTCCGGCTTCATTGTCACCACTGGATCTGCCAC
CGTCCCCATAAGTGTCACGATCGTCGACAGCGGGTCGGCCTTAACGACCTCAATCACCGCCCTAACCCTCGAAGCTCCCC
TGTTTCAGCTGATGGTGCAAGCCACCGACCGCATCACCACAAACACAGACTTCTCGTCTTCAGCAACCTCCATATTTCCG
ACTTCCTCGTCTAGCTTGTCTGCCACCTCTTCTCTCACCCATGCTCCTACGACAGGACTAAGCAAGGGCGCCGTAGCCGG
CATTGCTATCGGGTCTGTCGTGGGCGGACTCGCACTGCTCGGCGGACTTGCCTATCTCTTCTACCGGAGATACAATAAAC
ATAAGAAGCTAGGTCCTGGAGCTGTGCAATATACACAAGCGCCCATGGACCCACATACGGACAAGCCAGAGCTGATGGCC
GACATGTCAGGGACAAAGTATCCTACACCGGCACCAATGTATGAGGCACCGGTGACACCAGCACCAACGGCAGAGCTGCC
ATCACCGCCAGACCAGCTATATACACTGCGGTCAGAGTTGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62