GenePrediction:GLEAN_5692 Details

Name: GLEAN_5692
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1565346..1564325 (- strand)
Length: 1022
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1565346..1565305 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_173:1565250..1564924 (- strand)
Length: 327
Type: CDS
Source: GLEAN
Position: GCSC_173:1564865..1564767 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_173:1564708..1564325 (- strand)
Length: 384
>GLEAN_5692 class=GenePrediction position=GCSC_173:1565346..1564325 (- strand)
ATGAAGTTCCTCTGTCTCCCAGGCGCCTTTGGCAGCGCAAAGGTTCGTCAAGGCTGGGTTGTGCTCTCAGAATTTGCGTA
CTAACTCAGTCCTCAGAATTTCAAAATCCAGCTGGACCCCTTTGTCACAGAGGCGGAGCGACAGGGCACTGCTCGCTTCA
CATGGACGCAGGGAACGACAGAGGCGATTCCGCCTGCCGGCTTCGAGGACTATTTCGGTGCCGGTCCTCTGTATCGCTTC
ATTGACTATGACGGCGTCAAGGCGTATGATATTATGGAAAGGATCCGATACTTTCCGGAAGCAGAGACTGCTGAAGACAC
CATCAGATTGCTGATGGATGACTTTACCGGGAATGCCATTGACAGTGTCAAAGATACAGTGCAACGATTGATTGATATAA
TCGATGCTGATCCTGAAATTGAGGTAAAGTACACACGCAACTCAATTCCACTTCCGACAAGACGGCTCACAAAGTGACTA
GGGCATCCTTGGATACTCCGAAGGAGCAACTACAGCTGCCACTGTCGTCCTGGAGGAGCGACACCGGCTGCAGAACGAGG
GCAGGCCCAGACGCATCAAGGTGATTTTCAAGAGAGACCTTTCCCCGTGGAGGGAACCCCGCTGACACCACCTTGCAGCG
CGCCATTTTCTTTGCAGGATGGGCCCCACTGGCTATCGTGGACGGCAAGGTCAAGGTCTTACTGATGGATGAGAGCGAGG
ATGTGATAGACATTCCCACTTTGCATGTGGTCGGATGCAACGATCCATACATCCAAGGAGCCATAACCCTGTTCAACATG
TGCGCCGAAGAGGAAGCAGAAATTTTTGATCATGGAAAGGGCCATACAGTCCCAAGAGATCAAAGAACAATCTGGGAGCT
CTGCGATGCCATCGGCCGACTCGTGAAGAAGGAATGCACCTGGGGCGAAGACAACATCACCGCGACCGGAATTTCTCTAG
ACGCTCTCCAGGCTGATTTGGCCAAAGATGTCGCCGTGACGAGAGAAGGTGTTGTTGTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62