GenePrediction:GLEAN_5693 Details

Name: GLEAN_5693
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1562421..1561184 (- strand)
Length: 1238
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1562421..1562051 (- strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_173:1561997..1561184 (- strand)
Length: 814
>GLEAN_5693 class=GenePrediction position=GCSC_173:1562421..1561184 (- strand)
ATGGCATCGCAATCCGCCTCTCGAGCACTTACAATTTCCGCCCTGCTGGCTTGTGCCGGTTGGGGTGGCTACAGCGTTGC
CATCACGGGGATACGCAGTGGCATGTTCGCAGCCATCGAAGCCAGCATTGGCCGTGCTGACCCATACATCCCGGGCGGCC
CGGCGCCATATCGCACACACTTCACCGGTATTGCCGGCCTCGATCGACACCTGCTGACGCTCGTCTCCTTCTTTACGTTC
ATCATCGATGGCCCTCAGACGTGGTCCACTACACTGGCCTTCTGGTACCTCTGGGCGCATCTCTGTGCGGGCTGGTGCCT
CATTGCACTCGAAGGCCGTCGCCTGGGAAATAGCGGTTTGGCCGTCCGTTGGTTCGTCTTTGAACTGCCTTGGACTGTCT
CCTCCTTCTTCTGACCATCGCTAGGACCACCGCTGTCGGCATCATCTTTCAGAACATCACGTACACCGTCACCGTACCTT
TGTACCTTGTGCTGCACATCCTCACATCGCCCATCACAGCGGCCTCATCGCTTCCAGCAGATATCGTTGCGTCCAACATC
GCCGTCGACCCGTTCGACTCCGCTGCCTTGCCGCTCTGCAACGTCTTGGCCTATGTTGTCCCGGGCATAATGATGCTTCT
GCCTTCTCCAGGCCTCGTGCACCCCCTTGCCCACTACGCCTGGAATTCAGGGTGGCAGGTGTTTCCTGCCACTCAGAGTC
TCTTCCACCGACTTCTGCGTCTCACCCTGCTGCCTTCTCGCAACACCAGCACGATTCTACGTCAGAAGACAACGCCCGAC
TCTACATACCTGTACGTGCTTTTTGTCAGCCTGCTCAGCCAGATGGCACTCATCGCCGTGGCCGTCACGCCTGCGCGCGC
TGTGCCCAACGCGTTGGCACCCGTGTTTGCTGACGTAAGTCTGGCTTCGGCGTTCGTGCCCTCCTGGCCGAGCAACTCGC
CTGTCATCGACACGACTGCGGCGACTATCGCACCCCACGGCTTGGCTGAGGCAGTCAAATTATTCCTTCAGTGGGATGTT
TACTGCGGTGGTACGGCTGTCTTAGTGTGGGCAATATTTGTACGTGGCCAGACTCAGGCCAAATTGAGCATTGCGTCAGT
CTTGCCAAAGGTCGCGTTCTGGACAGCCTGTGGTGGACCGCCGGCTGCTGCTGCAATCTTGCTTTGGGAGCGGGACAGGG
AAGCTGCGGCGGGTGAGCCGAGGAAAAAGATCCTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62