GenePrediction:GLEAN_5694 Details

Name: GLEAN_5694
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1541926..1540249 (- strand)
Length: 1678
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1541926..1541372 (- strand)
Length: 555
Type: CDS
Source: GLEAN
Position: GCSC_173:1541297..1540332 (- strand)
Length: 966
Type: CDS
Source: GLEAN
Position: GCSC_173:1540275..1540249 (- strand)
Length: 27
>GLEAN_5694 class=GenePrediction position=GCSC_173:1541926..1540249 (- strand)
ATGGCGACTCTCGTCGACGAGGAGAAGAAGGCGGAGCGCTTCAGCATCAGCGAGCCCAAGCTTGACCTGGAGATCGGCGA
TGTGCACGACCTCGACGAGGCCGAGATCTTCCTCCGCGACAACGGCTATGGCCCGGAACGGCTGCAGGAGCTGCTCAGCG
ACGAGGCCGGGGTCAAGAGGCTGATCCGCCGTGTTGATCTGCGGCTGCTCCCCCTGCTCGCGGGCACCTATGTGCTGCAA
TACATCGACAAGCAGGCGCTGTCGTACGCGGCCGTCTTCGACCTCTTCAGCGACACGGGCATCAACCAGAATCAGTACAG
CTGGTTTCCCAGCATGTTCTACCTCGCCTACCTCGTGGCAGAGTATCCCTGGAGCGCGCTGGCCCAGCGGACGTACATGG
CCAAGGTCGTCTCTGGCTGCGTCGTCGTCTGGGGCGCCATCCTGATGCTCACGGCGACCAGCAGCAACTTTGCCGGCATG
GCCACCTGCCGCACCCTCCTCGGCGTCTTTGAGGCGCCTATCACGCCCTGCTTCATGATGATCGTGAGCATGTGGGTATG
TGACTGCGATGCTGTCTGATTCCGTGCAGGACATGTCCTCGCATGCTGACGTGTGGTATCTCGGTCTAGTATATGCGGGA
CGAGCAGCCCTTTCGGGCCGGCGTATTCTACAGCTGCAACGGCGTGGGTGCCATGATCGGCGGCATCTTGTCGTACTGCA
TCGGCCAGATCGACACGTTCCCGGTGTGGAAGGCCATCTTCCTGCTCTGCGGTGGTCTCACGGTGATCTGGGGCGTGGTC
ATGTACTTCTTCCTGCCCGACGACATCATGTCGGCGCGCCAGTTCAGCGTAGAGGACAAGGCCACGCTGATCGCTCGAGG
CAAGGTCGGACGCACCGGCATCCTCAGCCGGAAGATCAAGTGGAGCCAGATGCGCGAGGCTTTTCTCGATCCGCAGGTCT
GGCTGTTGTTCCTCTTCACGCTGCTCAACGAGGTGATCAACGGCGGCATCGCCAACTTTGGCAAGCTCATCATCAAGGGC
CTGGTGCACGACGCGCTCCGCACAACGGCGCTGGGCATTCCGCTGGGTGCCTTCCAGATCGTCTGGATCCTGTCGGGCAC
CTACATCGCCTCGCGCTTCCGCAACGTACGCACGTTTGTCATGATGGCCTACCTCGTACCCACGATCATCGGCGTGGCCC
TGATGTGGAAGCTGGATCGTCACCACCAAAAGGTCGGCGTCCTGTTCGGCTACTACATCTCGGGTGCCTATGTTGCTTCC
CTCGTCGTCACTCTCCAGATGCCGGCGGCCAACCTGGCCGGATACACGAAGCGAACCACGGGCACGGCCATCGTCTTTGC
CGCCTATTGCATCGGCAACGTTATCGGCCCTCACGCCTTTCTCGACTCCGAGGCCCCCATCTACCAGACTGGCTGCAAGG
TGTGCATGGCCTGTGCCATCTGTCAGGTGGTCGTGGCTGTTTGTCTGCGCGTGCTGCTAGTCTGGCGGAACAAGCAGAAG
GATGTCGCACAAGGAGCGGTAGCTCTGGACGATCCGGTTGTTGATGAGCTGACCAATGACATCACCGACTTTGAGGTACG
CGTATACACATGTTTTGCGTGTTGAATAAAACGCTAACTTGTTGTCACCAGAATCCGCGGTTCAGATATATGCTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62