GenePrediction:GLEAN_5695 Details

Name: GLEAN_5695
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1538226..1537198 (- strand)
Length: 1029
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1538226..1537198 (- strand)
Length: 1029
>GLEAN_5695 class=GenePrediction position=GCSC_173:1538226..1537198 (- strand)
ATGGCCCAGACTGAATCCTGCGTCGTGTCTGGCGCGAACATCCACCTGGACGGCGTGTCGCCCCCACGACTGGACTTGGA
AGCCGACAGCATCTTCGACATTAGCCCGCTGGTGGCACTGCAGCTGCTATGCGCCAGCGTCGAGGCGCTCGTGCGCATTA
CCGGCGACGTGCCCCCGTCCCCGCCGACATCAGGGATATCTACCGAGACCAACATGCGCGAAATGGACGCTGAGAAGGCG
TCTATTGTGCGCACGCTCAGCGCCAACAGCCTCGCTCAACTGCGGGCGCAGGCCGAGAAGCTGGACAAGTCGGCCGGTGT
GCAAGTCCACGAGAGAAGTCTCGACATGTCCACGCCGTCTGCTCGGTTGAGAATGCCACCGACACCACCGCCCGTGCGAC
CGATCGTCATGGAGATCGACGGCGTGCATCTGAAGCAGTCATCCCCCAGCGGGCCGCCAGAACGGGAGCCGACACCCCTG
TCGCCTAAGAGCATGAGCACGTCCCCGTCCGCGGCAGCAGCAGCGGCTTTCACGCCCGTGCCCTATATTATCATTGGTGC
CGACTCGCAGCCGTTAAATGTGCAGCACTCAGCCATCTCGCGCAAGTTTTACAGCAAGGCGGTGCCGCCATTTAGCATAT
CACAGTACCTGAAACGCCTACACCGCTACTGTCCCATGAGCACGGCCGTATACCTGGCCACGAGCCTGTACATATACCGG
CTCGCGGTTATCGACAAGGTGATTGCCGTGACGCGGCGCAACTCGCACCGGCTGCTGCTGGCCGGCCTGCGCGTGGCCAT
GAAAGCGCTCGAGGACAGGAACCATTCGCACTCCAAGATGTCCAAGGTTGGCGGTGTCAGCGAAGCCGAGCTGGCACGGC
TAGAGATACACTTCTGCTTCCTCGTTGGCTTCGACGTCATCGTGCAGGCCGACCAGATCCAGCAGCACTGGCTGCTGATG
AAGAGGGGATCAGCTCTGGGCCCGCTCGACCTGGACGAGACAGTGACCATGACGGTCATGGCGTCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62