GenePrediction:GLEAN_5696 Details

Name: GLEAN_5696
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1536655..1535139 (- strand)
Length: 1517
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1536655..1535471 (- strand)
Length: 1185
Type: CDS
Source: GLEAN
Position: GCSC_173:1535411..1535305 (- strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_173:1535241..1535139 (- strand)
Length: 103
>GLEAN_5696 class=GenePrediction position=GCSC_173:1536655..1535139 (- strand)
ATGACTGACTACGACGAGGTTCTCAGGGGCAAGTACCCGGCCAAGGCGCACGCGCAGCGGGTCGCCGACTACATTCGGGC
CAAGGTGCCAGCGGCGAGGGCGAAGCACGGGGTGATCTACCTAGAGAGCAAGGCGACACGGCTGCTGGAGGACAACGACG
AGCCGGAGCCATTCCGGCAGCGGCGGCCGTTCTTTTACCTGACGGGCAGCACGCTGGCAGACGCGGCAGTGGCGTACGAC
ATGGCCAGCGGGAAATCGACACTCTTCATCCCGCCTGTGGACGCAGACACCGTCATCTGGTCAGGGCTGCCGGTGACGGC
CGAGGAGGCCAAGGCGCGCTGGGACGTGGACGCGGTGCGATATGTGGAGGAGGTAAACGGGTTCCTGGCCGGACTAGCCC
AGCGGCCGGGTTCGGTGGTGTTTGCGATGGCCGGCCAGGTGGCCGACGGGACGACCTTTGTGGGCTTTGACGAGGCCGAC
ATGGAGCTTCTGCGTGAGGCGGTCGAGGAGGAGCGAGTGGTCAAGGACGAGTACGAGCTGGCGCTGCTGGCCCGGGCCAA
CGCGGTGTCGAGCGACGCCCATCGCGCGGTGCTGCAGCGGGCACGCGGCGCCGCCAACGAGCGCGAGCTCGAGGCCGTCT
TCCTCGCGCATTGCGTCGCCCACGGCGCGCGCGAGCAGTCGTACAGCAGCATCGTGGCCAGTGGTCGGGCCGCCGCTACG
CTGCACTACGTGCGCAACGACCAGCCGCTTGCCGGCAAGCTCAACCTGCTGCTGGATGCCGGCGCCGAGTGGGACTGCTA
TGCGGCCGACATCACTCGCACCTTTCCCCTTGGCGGCCGCTTCTCGCCCGAGTCTCGGGCCATCTACGACATCGTCCTGC
GCATGCAGCTCGAGTGCATCGACCTCCTGCGCGAGGGTGTACTCTGGGACGACGTCCACCTGCACGCCCACGCCGTCGCC
ATCGACGGCCTCCTCGACCTCGGCATTCTGCGCGGCGACAAGGCCGACATCCTGCGCGACCGCACCAGCGTCGCCTTCTT
CCCCCATGGCCTCGGCCACTATCTCGGCATGGACACCCACGACGTCGGCGGTCACCCCAACTACGCCGACAAGGACCCCA
TGTTCCGCTACCTGCGCGTCCGCGGCACCCTCCCGGCCGGCAGCGTCGTCACCGTGGAGCCGGGCGTACGTCGATGCCTT
CTGTTTGTCTGCTTCTTCTGCTGTCCACCTTCTAATGCCTGCAGATCTATTTTTGCGAGTTTATCATTCGCCCCTATCTC
AAGGACCCTGTCCACGCCAAGTACATCGACACGGACGTGCTTGACAAGTACTGGGACGTCGGTGGTGTCCGGTACGTCTG
TTCCTGCATGTTCTCTCCATCTTGTCTCTGCGCTGTCTCTTAACACTACATTAGAATCGAAGACAATATCGTCATTACCA
AGACAGGATGCACAAATCTTACACCCGCCATCAAGGATCCAGAAGAGCTCGAGAAGATCGTCAGCGGGTCGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62