GenePrediction:GLEAN_5697 Details

Name: GLEAN_5697
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1533991..1533656 (- strand)
Length: 336
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1533991..1533656 (- strand)
Length: 336
>GLEAN_5697 class=GenePrediction position=GCSC_173:1533991..1533656 (- strand)
ATGCTGGTCCTGCAGCGGACCATGCTGTCTGTCGAAGACCACAGCTTTCTGACGGAATTCGTCCTGAATAGCTTTATGTC
GTGGAGATCCGCCGACAGCGGCATGTCTGCTGATTATCTGGCGCAGCTCTTGGATATTTGGGATTATGCTGTTTTTCTGT
TCTCGACCAGTCCCAGTCCCACTATCAACGGGACGGCACAGGACAACGTGGACACCTCTGTTGCCCCGTCGACCTCTACC
GCTGTCTGTGACGCCCGGACTATATCGCTAGATCGTGTGTGGTCTGATGTCGGCCGTGGTGCTCTAGCAGCCTGTCTGGT
GATCGGTCTTCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62