GenePrediction:GLEAN_5698 Details

Name: GLEAN_5698
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1525870..1524915 (- strand)
Length: 956
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1525870..1525408 (- strand)
Length: 463
Type: CDS
Source: GLEAN
Position: GCSC_173:1524922..1524915 (- strand)
Length: 8
>GLEAN_5698 class=GenePrediction position=GCSC_173:1525870..1524915 (- strand)
ATGAGCGCTCCGCCCCCGCCTCCGCCCCATGGTGAGGCCCCGAAAACCACGGGCGGGAGCGGACTGCCACCGGGCAAATA
TGACATATTCGTCATCCCAGAGCACTCGGCCGGTGCGGGCTTCCTCTACCTGCCATCGCTGCGACCCAATATCAACAGCT
TCGTTGCCGGTTTTGCTAGCGCCTTGGCCGTTGTTGCTGTTGGCCATACTTTGGCACCAGCATATAGGGTATGGTCGGCA
AACTACCAGGGAATAGGAGACTTGGGGATGATGATGCTCGTGGTCGCTGTCGGGCTCGGCGCATGGGCACTTGGCCGCAT
ACAAAACGACAAGTCGGGGTCCGGTGCTGGGACAGGCTTCAAACGAGGCTTTGATGGTTTTGGACAGGGCGGTGGGGCCG
GCGCATATGCAGCGGGTGGTAACGCTGGTTACACCTCCGGCTCGACACCACAGCAAGGTCCCAGTGCGTCAAGTCAGCCA
CCGCCAAACAGCGGCGCACACCCTCGCTCTCCGCCTTCCGGACAAGGCCCACAGTCCGGTCCTGGGCAGTCGTGGTCCGA
CGATGCCAAAGCCTCTTGGCAGAAACATCAACAGGAACAGGAAGAGGAGGAGGAACGGGAACGGGAACGTGAGCGCCAGC
AACAAGAACAGGAAGAGCAAGAGCGGAAGGTGAAAGAAGAACTCAAACGAAAGGAGAAGGAGGAGCAAGAGCGCAAGGAC
AGAGAGGAGCGACAACGAAAGCAAAAAGAAGAGCAGCGGCGCCAAGAGAGGGAAGAACGAAACCGGAAGGAGAGAGAAGA
CCAACAGCGAAAGGAAAAAGAGGAGCAAAAGCGCAAAGAGAGAGAGGAGCAAAAACGGAAGGATAGGGAAGCGCTACTAA
GGAAGGAGAAGGAAGACCAACAGCGGAAAGAAAAGGAAGAGCAGCACCGCAAGGCAAAAGAAGAGCAGCACCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62