GenePrediction:GLEAN_5699 Details

Name: GLEAN_5699
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1521973..1516725 (- strand)
Length: 5249
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1521973..1519517 (- strand)
Length: 2457
Type: CDS
Source: GLEAN
Position: GCSC_173:1519121..1516725 (- strand)
Length: 2397
>GLEAN_5699 class=GenePrediction position=GCSC_173:1521973..1516725 (- strand)
ATGGCGTCCCAAAAACGCAAGGCGAGAAGCGATGATTTCTTCTACTACACACTCGAGGATGAGGAGGTTCTCGGCGACGC
AGACAAGCCTGTGTCAAAGAAGGCCAAGAAGGCAGACGCTGTAGACGAAGAAGACGAGGGTGACGACGAGTTCGACCCGG
GGTTTGAGTTTTTCGACGGCGGATCCGATATTGGATTTGAAGATGAAGAAGAAGCCCCTGCCAGTCACGGTCTGGAACTG
AAGGGAGCAGAAAGAATTGTTGACCTGAACGAGCTCATCAAACAAAGACGAGAGCGGAAGGAAGAAGAGGCGAAGAAAGA
AGCGGAAAAGAAGGAGAAGAAGGAGAAGAAGGCATCTGCCATTACCAGCAAGGACGATGAGGATGACGAAGAGGATGAGG
ATGAGGACGTTGACTTTGACGACGCCGACGATGAGGTGCTTGCAGCCGACGGATTCGGCATGGGTGCCGACTCAGACGAA
GAGGAGGAGGAGGAGGAGGAAACAGAAGGCAAGAAAGGAAGTGACGAGGAGGAGGGGAGTGAGAAGGAGGATGAGGAGGA
TGAGGACGAGGACGATGCGGCATCGGACAACGACTCGGTGGCCACGCCGGTCGGTCATCCGGACGATAATAGTCGGGACG
ACGATGCATCGTCGGTGTCGTCGGATGAGGACATGGAGGAGCGAGCACGACAGGAGGAGTACTTTGCGGCAGGCGAGAAG
GAGAAGAAGAAGAGCGGGTCGGGCAAAGGAGCGAACGGAGGAGCGAACGGATCGGACAAGACAGCGATGTCGTTCCAGGC
GATGCGGCTGTTCTCACGACCGATTCTGCGGGGAATTGCGGCGGCCGGATTCGACACGCCGACGCAGATCCAGGCCAAGA
CGATTCCGTTTGGCATTGGGGGCCACGACGTGGTGGGCCAAGCAGTAACGGGATCAGGCAAGACGGCGGCATTCCTGCTG
CCGATTTTGGAGCGGCTGCTGCACCGGCCGACGAACGTGCCGAAGACGCGGGTGGTGATCCTGACGCCGACGCGCGAGCT
GGCGGTGCAATGCCACAAGGTGGCGGTGAAGCTGGCGGCGTTCACGCCGATCACGATGGCGCTGACGGTGGGCGGAACGT
CGTTCAAGTCGTCGGAGGCAAGCCTCCGGTCGCGGCCGGACATTGTGATCGGCACGCCAGGACGGTTCATCGACCACATG
CGCAACTCGCCGAGCTTTGCGGTGGACGGGGTAGAGATCCTGGTGCTGGACGAGGCGGACCGGATGTTGCAGGACGGGTT
TGCGGACGAGCTGAACGAGATCGTGCAGACGCTGCCGCGAGGCCGACAGACGCTGCTCTTCTCGGCGACGATGGGGGCGT
CGGTGGACCAGCTGATCCGGGTGGGGCTAAGCCGGCCGGTGCGGATTCAGGCGGACGACAAGTCGCGGACGGCGGGGACG
TTGACGCAAGCGTTTGTGCGGCTGCGACAGGGACGCGAGGACCGGCGGCTGGGGTACCTGGTGGAGCTGTGCACAACGCT
GTACCGAGACCACGCGATCATCTTTTTCCGGGAGAAGCGCAGCATCCACGAGGCGCGGATCGTGTTTGGGCTGCTAGGGC
TGACGTGCGAGGAGCTGCACGGCAACATCAAGCAGGCGGAGCGGATTGCGAGTCTGGAGTCATTCCGGCGCGGCGAGGTG
CAATTCCTGCTGGCGAGTGACCTGGCGTCGCGTGGACTGGACATCAAGGGCGTGGAGACGGTGATCAACTACGAGGTGCC
GAAGAACCTGGACGATTACATCCACCGGATCGGGCGAACGGCGCGAGCAGGCCGGCGAGGTCTGGCGGTAACGATCGTGT
CGGAGAAGGACCGCAAGTTTGTCAAGGAGGTGGTGAAGGCGATGCGGGCGGGAGGGGACAAGGAACAGAAAGAAAAGAAA
GGCAAGACGGTGGGTGAGACAGGGTTGCCGATGCCGCAGCAGGTTCGGATCCGCAGCCAGCAGGTAGACCCAGCAGCAGC
AGACCGGTGGCAGGCCAAGATCGATGCGATGGCTGAGGACGTGGCCGAGATCGTGGCGGAGGAGCGACAGGTGCGAGCGA
TGGCGCAGGCAGAGATGGAGGTGACGCGCGGAGAGAATTTGCTGAAGCACCGGGACGAGATCATGGCGCGACCGAAGCGG
ACCTGGTTCGAGAGCGGGCGCGACAAGGAGGCGAAGCGGCAGCTGCAGCGGCGCGAGGCGCAGGCGGAGCGGTCGGACGA
GACCAAGAAATCGACGATGGAGCGGCTGCGTGACCAGCTCAAGGCAAAGCACGGTGGTAGTGGTTGGCTCAGCCGCAAGG
ACACCAAGAAGCTGGACGCCAAGAAGGACCGGCTCGAAGGCCTGGGCGGACGCAAGTTGAAGCAGGAGAAGAAGGAGCTG
GGCGCCAGCGGCAACAACAAGGCGCGCGGCAAGGTCATCAAAGGCGGCAGCAAAAAGGTGAGCATGGGGCCCAAGGTGAA
GGGGGGGAGACCGGGAGGGAAGCCGGGGGGAAGACCTGGAGGCAAACCAGAAGGCAGACCGGGCGGCCGATCTGAAGGGC
GACCGGAGAGGTCAGGAGGAAAGCCAGGTGGGAGGCCGGGTGGGAAGCCGGGAGGGAAGCCAGCTGGAGGAAAAGGTCGA
AGATAGAGGTTGTTAGTGGTAATGAGGTAGAAAAGAACCAAGATCAAGGATCACATGACAATACTCGTGACTACAGAATG
TAACGCCTAGACTTGGGGGTAGTCCAACACTAATCTGACAGGCACGTACGGAGTACCCGTACTTGCGGAAGGAGCTTATG
GTGGGCCTTAGGCAACAAGCTCATGACAGCTTCCCCTCTCTTTTCTCCACAGCAGCAAATACAAACGGATTGGTTAGAAA
GCAAAGCACGCAGCGCCTCTGACAGCGGCTTTACGGACGACTGCAGCAGGTCCAGTGCACAGGCGCCCGCGATGGAGGAG
CGCGGGTCTCGACGGCGGCGGCTGGCGGCAATGGCGGGCACGGTGTATCGAGCAGGCGTAGCGGCGGCCAGCGAGATCCG
GGAGCAGTACAACAACAGCTCATGGGCACGAGAGGGCGAGGACGGAGGTGATGGCAGCAGCGGCGACACGGGCTTGGACG
ATGACCGGCCGCCGAGCATTCCGGGGGCATTTCCAGACGTGGCAATTGCGACGAGCGGCGACGCCCAGATGATCTTATTT
CCCAACTACTCGATGCGGCACACGAGGCGATTCCGGGAAAGCGGAGTAGGTATTGTTGATCTGGACAGCAATGGAGGAAA
CGGGCTCGGGCTCGATGACGGAAGCATGGACTGGCACTACGAGTTTGCGCGGCGCGAGGACGAAAAGGCCGTGGTGGACG
TGTATGTGCACGGCTGGATCTACCTGCCACAGCGAGGGCCGCTGAACCGGAAGAACCGGCTGCTGGTGGGCCTGGCACGA
CGGCTGAGCGGGATCACGGCAGCCCAGCAGCAGCAGCAAGTGCAGCAGCAGGCGGCCTTGGCGGCACAGCAGGCGGGCGA
GCAGCAGCGGATTGCGCGCGAGGCGGCGGCAATTGAGCGGCGTGGCCAGGGCGAGAAGGAGGTGGCCACACGGGGAGGTT
ACAGCGAGACGGCCGAGAGGGCAGCACAGTACGACGACGACGAGATGACAGAGGCTTTTCGTCTGAGCAGCCAGACGGGC
TTTCGTTCTCCTTCACCATCACCATCGCCGCCGACAACGACGACGACGACGACAAACTCACCGGCAACTGAGATGAGCGA
GGCGGAGCTGGCCAGGGCCAACACGAACCTGATGGCGCGGCTCAGTCCGTTCCTGACGACGCCGGTAGTACAGCAGGCGG
TGACGCTGTTCTTCTATAGCGCCACACAGTCACAGTCGCGCACGTTAGAGACCAGCGATGCCGGGCACTTTTCGGCCTGC
ACGCCGCTGGATTTTGTGCCGACGCACGTGCGGGTGTTGGTGCCGACGCTGGAGGGGGGTAATTGGGGTTCGGGAGGGGG
GGCGAACGGGACCGGTTACGGCACCAGCAACGGGACCGGTTACGGAAGCCGGTCGCTGTCAGACCGTCCTCTCTCGGCCT
CGCCCCTCTCAGCCGTGGCGCCCGTCAACCTGGTAGAGGACCGTGGCGTCAGCCTGATCAGCGACATTGACGACACGATC
AAGACGTCCAACATTGCGCTGGGCACGCGCGAGATCTTCCGCAACACGTTTGTGCGCGAGCTGGACGGCATGGCCGTCGA
CGGGACGCAGACGTGGTACGGCCAGCTGCGACGGCTGGGCGTGCAGTTCCACTACTGCTCCAACAGCCCATGGCAGCTGT
TCCCGATGCTGGCCACCTTTCTGGCCTGCAACGGCCTGCCGGCCGGGCCGCTGCATCTCAAGCAGTACAGCGGCATGCTG
CAGGGCATCTTTGAGCCCGTGGCCGAGCGCAAGCGCGCCACCCTCGAGCGCATCCTGCGCGACTTTCCGCAGCGCCGCTT
CCTGCTGGTCGGCGACTCGGGCGAGGCCGACCTGGAGGTCTACACCGAGCTCGTCCAGGCCCATCCAGGACGCGTGCTAG
CCATCTTTATCCGCGACGTCACCACGCCAGAGCAGCCGGCCTCTCTGGAGGTACAGTCACAGTCACAGCCACAGCTAATA
CCACCACCACCACCACCACCACCACCACCACAACCAAGACCACCTCCCGGCCCTATCATGGGCACTCTCATCGACCTCGA
CGACGACCCTGGTGTTCGCACGGCTAGCCCGGCTTCGTCGTTGCGGCCACCCGGAAGCCGCAAGCCCGTACCGCCGCCGC
GGCCCAAACCCGCGGCCCTGCGCGGCTCCATGACCGTGTCGTCTCCCTCGGTCGCAGTCGCCGTCTCGCCCGCCTCCCGT
CCACTACCACCACCACCACCGCCGCCTCGACGCACCGCCACCGCCGGACCATCCGGCAGTCCCGTGCTGGGACCACAGTC
GCAACGGCCGCCCCGACGTGTCCGCACCGGCGGTCTTGAACACCCGTCACCACCGCTCGGACAGGACGTGCCTCGGATAC
AGGCTCTCGCTCAAGAAGCGTTGCCAGCTCGGACACAGACCCCTCCGACCCAGACCCCCAATCGCAAAGTCGACCTGTGG
CGCCGTCGGCTGGCCCGCGCAGAGGACGTGCTGATCCCCTTGGGCGTCGCGCTGTACACCTGGCGGCGCGGCCAGGACGT
TGCCGCCGAAGCCGTAGGCATCGTCAGGACGGCACTGGACATGAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62