GenePrediction:GLEAN_56 Details

Name: GLEAN_56
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:382218..384100 (+ strand)
Length: 1883
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:382218..382323 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_179:382383..382539 (+ strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_179:382614..382647 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_179:382705..382926 (+ strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_179:383003..383378 (+ strand)
Length: 376
Type: CDS
Source: GLEAN
Position: GCSC_179:383444..383455 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_179:383517..383583 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_179:383650..384100 (+ strand)
Length: 451
>GLEAN_56 class=GenePrediction position=GCSC_179:382218..384100 (+ strand)
ATGTCGGAGGCGGTTAAGGACGACGAGTACACGATCAAGCCTCAGGCGACCGCGCCGGCTGTCGATACGAGCAACTGGCC
TCTTCTCCTGAAGAACTTCGACAACTGTGCGTTTTGCATGGCGGTCGCTCCGAGAGAGGGGGGTTCCTTGTGCTAACCCG
TCTAGTGCTCATCCGCACGGGTCATTTCACGCCCATTCCCCACGGCAGCTCGCCGCTGCGTCGCGATCTCAAGTCCTATG
TCAGCTCGGGTGTGATCAACTTGGACAAGCCGTCGAACCCGTCGAGTCACGAGGTGGTGGCATGGGTCAAGCGCATTCTC
CGGTAGGTGGTTGTGTGGACGAGGGAGCGTCGACAAACGGCAGGCGGGGCAAGCATTTACTGACCGACTTGTGCAGCGTC
GAGAAAACTGGCCACTCTGGTACTCTGGATGTACGTTTCTATCTGTCCTCTCCCGCTCATCTTCACGCTTGTTTCTGACC
AGTTTAGCCCAAAGTCACTGGCTGTCTGATTGTCTGCGTTGACCGCGCCACTCGCTTGGTCAAGTCCCAGCAGGGTGCCG
GTAAGGAGTATGTGTGCATAGCCCGCCTTCACGGCCGTGTGCCTGGTGGTGAGCCGCAGGTGGCCCAGGCTCTCGAGACC
CTGACGGGTGCGCTCTTCCAGCGTCCGCCTCTTATCTCGGCCGTCAAGCGGCAGCTGCGTATCCGCAGTGTAAGTTGAAC
CACTTTCAACCACTCTCCTCTCTGCCAAGCTTGGAAATAAGCTAACTTCTTCGTGCTCCTCCTAGATCTATGAGAGCAAG
GTGATCGAGTTCGACAACGACCGTGGTCTTTTCGTCTTCTGGGCCAGCTGCGAGGCCGGCACGTACATGCGTACGCTTTG
CGTCCACCTGGGTCTGTTGCTCGGCGTCGGTGCTCACATGCAGGAGCTGCGCCGTGTCCGCAGTGGCGCCATGGACGAGA
CCAAGGACCTCGTGACGCTGCACGACGTTCTCGATGCTCAGTGGCTGTACGACAACACGCGCGACGAGTCCTACCTCCGC
AAGATCATCCAGCCCCTCGAGTCGCTTCTGACGGGCTACAAGCGCCTTGTCGTTAAGGACAGTGCCGTCAACGCCGTCTG
CTACGGTGCCAAACTGATGCTTCCGGGTCTTCTGCGCTATGGTATGTTTTCTCTCTATGCCTGATTTGTTTTTAATGGGA
ATGGCGGCTTACTAACAACCTCACAGAAACTGGCATTGGTACGTGACATGGCGGCGATGCAAGTCAGCAGCATCTACGTA
CATTAGCTAACAATCTTAGAACACCACGAAGAGGTTGTCCTCATGACCACCAAGGGCGAGGCCATTGCCATTGGTATTGC
ACAGATGTGAGAATCCCGTTTCCTTTTTCACACCTTTGTTCATACGGTAGCTCTTCATACTGACTATAGCAGGTCCACTG
TCGAGATGAGCACCTGCGATCACGGCGTTGTTGCCAAGGTGAAGCGCTGCATCATGGAGCGCGACCTCTACCCCCGGCGG
TGGGGCCTCGGCCCCGTGGCGGCGGAGAAGAAGAAGCTCAAGGCAGATGGCAAGTTGGACAAGTTTGGACGGCCGAATGA
CGCGACACCGGCCAAGTGGGCGGATGGCTACGTTGACTACTCGAAGCCGGGTACGGGTGCACCAAGCTCTGAGGCTCCGG
CAACAGAGGCAAGCGCTCCTGCTGCGGCGACGCCCTCCAAGGCTGCGGCTGTTGAGGTTGCCGAGACGCCGGCGACAGAG
GACAAGGACAGCAAGAAGCGCAAGAAGCACGAGGGCGAGACTGCTGAGGAGAAGGCAGAGCGCAAGCGCCGCAAGGCCGA
GAAGAAGGCCAAGAAGGCTGCTGCTGGCGAGGACAGCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62