GenePrediction:GLEAN_5703 Details

Name: GLEAN_5703
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1490415..1488506 (- strand)
Length: 1910
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1490415..1490030 (- strand)
Length: 386
Type: CDS
Source: GLEAN
Position: GCSC_173:1489970..1488506 (- strand)
Length: 1465
>GLEAN_5703 class=GenePrediction position=GCSC_173:1490415..1488506 (- strand)
ATGGCGCTGTCCATCATGCACAGACTGCCGTTTGCGCGGTCGACGACGCCGCTGCAGGCGGCCACGTACCTGTTGGGCAT
CTCGCTCTTCTCCATCTCCTTCCTCGTCTTCCTCAACAGCAGCATCTCGTTTGTCATCACAGACCGCATTGGCGTCAAGA
ATGGTGTGGGTGACATTGTCGGCACGCTGGGCTTCGTCGACGAGCTTGTCGCCCTGGTCGCCTGTCCCGTCTGGGGTCTC
GTGTCCGATCGTCTGGGCGTGCGTCTGGTTGCCGTCATCGGCTATGCTGTCATCGCTCTCGCCCTCGTCCTGACCGTTAC
GGCTGTCAATGTGTATCCCCAGCTGCTGCTGGCTCGTATTTTGTTTGCCATTGGGGCCACGGCAGCGTAATTTTGATCTT
CGCTTTCTCTTCTTTCCATCTCTGCACTCCTTACTAACTCCTCAGGGCCACAATGGTCACAGCTATTCTGCCGTCTCTGA
CGGCTGAGACGGCAGACACGTCCCAGAACGACGATGCCGCCAACAGCCCGCCCAAGACGAGACGCAACCCCCGCGACAGT
GCGCTCTCGATGGAGTCCCAGCTGACCATCACGCCCGAGCGTTTTGCCGAGAGCCAGCAGCAGCAAAGCCGTGCCGATAG
CGACGACGATTCGCAGGCTGCCAGCAAGCCTGGCAAGCTCGCCGGTTTTGTCGGCGTCTTCACCGGCTGCGGCGCCCTCG
TGGCCCTCTCGCTGTTCCTGCCGCTGCCGGCGCAGTTTGGCCGCGTCGACGGCATCACCATGGCCGAGGCCGTTGCCCAC
AGCTTCTACGTCGTCGCCCTCGTCGCCCTCTTCATTGCCGTCTTTGTCTTTTTCGGTCTGCGAGGCCTACGTGGTGAGGA
AGGCAAAGGCTGGCACATGCTGCTCGGCCATCCTTCTGCTGCAGCCCCTGCTGCTACGTCTTCTCCTTCTTCATCTCGCC
GTCGTACCGACTTGCTCAGCATCGACGAAGTGCTCGCGGAAAGCCGAACGGAACAGCCCCCCTCTTCTTCACCCGTCCCA
TACTGGCGACTGCTCCGTGACTCTGTGCGGCTCGGCTTCACCGACGCCGACATTGCCCTCGGCTACCTGGGCGGCTTCGT
GGCCCGTGCCTCGACCGTGGCCATCTCGCTGTTTGTGCCGCTCTTTGTCAACGCCTTCTTCATCCGCAACGGCTACTGTC
AGGGCTCGCCCCACGACTCGTCGCCTGAGCTGAAGGAGGAGTGCCGTGCTGCCTACGTGCTGGCGTCTATCCTGACGGGT
GTCGCCCAGCTGATGGGCCTGCTATGCGCCCCGCTCTTCGGCTACCTCTCGAGCCACCGGCCTGGTCGCGTAAATGTGCC
CATCGTCGTGGCCAGCCTCTTTGGCGTCGCCGGCTACCTGCTCTTCGCCCTGCTGCCGAGCCCTGAGTTCAGCGACGAGG
CTGGCCGTGGTGGCTCGCCCATCGTCTTCCTGGCCGCCACCCTGATCGGCATCAGCCAGATCGGGGCCATCGTATGCAGC
CTTGGTGCCTTGGGCAAAGGCGTCCTCGCGTCTGGACACAACGACATCACCACCGACGGCCCTGAGACCGCTCCACTCCT
CGGCGCTGGCCTTGACGGATCTGCCTCCTACGACGGCGTTGATGCCGAGGCCACCACCAGCCACCACCGGCGGCTATCCT
CTGTCCCGGGGACGGCAGCCTCGCGCATCCGCCTCAAGGGATCCATCGCCGGCATGTATTCGTGGTGCGGTGGGGCTGCC
ATTCTGCTGCTCACCAAGCTGGGCGGTTATCTGTTCGACCACTGGACCACGGCCGCCCCTTTTTACCTCATGGCTGCCTT
TAACGTGGTCCTTCTTGTGGCCAGCGTCAGCATCGATGTTGGGGGGGCCGTCCGACGGTTGTCGCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62