GenePrediction:GLEAN_5705 Details

Name: GLEAN_5705
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1473023..1472047 (- strand)
Length: 977
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1473023..1472984 (- strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_173:1472909..1472047 (- strand)
Length: 863
>GLEAN_5705 class=GenePrediction position=GCSC_173:1473023..1472047 (- strand)
ATGGCGCCGATTGAGCCGTCCCCGACGGCGCCGGCCGAAGGTGTGTCTCGTGCTCGCCCTTGTGCCCATGTTCGAGGCGT
TTCGTGGAGTTTCCAGTGCTGACGTTTCTGGCAGCGGCCATCCGCGACACGATCCAGTCGCTGTACAACGTGATGCTGCA
CACGAGCGCGTATGACGCGGCCGGTCCGCAGACGACGCTGGACGCGCTGGTAGCCGAGGTGCAGGTGCTGTCGCGAGCGC
TGCAGTCGGCCGCAGCCGCGAGCAGCACCACGACCTCGACCACGACCACGACCACGACCGCCCTGCCGTCCGTTCCCCGC
GACCTGGTGCAGTACGTCGAGGCTGGCCGGAACCCCGACATCTACACGCGCGAGTTTGTCGAGCTCGTCCGCCGGACGAA
CCAGCTGCGCGCCGGCAAGCGCGCCGCCTTTGCGCAGTTCCGCGACGTGCTGGCCGGCCAGATCCGATCGGCCCTGCCGG
AGCTGCAGCCAGACGTCGACCGGGTCGTCGAGAGCACCGGCGGCGGCCGAGGGACAGCGAAGACATCGGAACACGAGCCG
GGACAGGAGTCGGGACAGGAACCCGGACGAAATGCAGTCTCCGTGCCCACGACGACAACCAACACGTCAGCTTCGACTTC
CACGCCCTCCACGGCTCCTGCTCTTGCTTCTTCTTTTGCTCCCTCCTCCCACTCGGCTCCCACATCGGCTCCCGCTCACA
CCGTCTCCCTGACCAACCGCTCCATGTCCGCCTCCGCTTCTGCCTCGGCTTCCGCTTCCGCCTCCGCCTCACCCCCTCTC
GGCCTCACCGGCGGCACGCCCGGCTCCGATGCCGGCGGCAGCACCATCGACATGCTCGGAATGCTGCCCGGAACGCCGCA
GACCAACACCGCTCTCCCGCCCACCTCCAACACCGCTGCTGCCCCAACGTCAGCCGCCGCCGGCAGGCCAGACGGCAACG
CGATGCAGACCACCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62