GenePrediction:GLEAN_5707 Details

Name: GLEAN_5707
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1460158..1459734 (- strand)
Length: 425
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1460158..1460087 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_173:1460024..1459734 (- strand)
Length: 291
>GLEAN_5707 class=GenePrediction position=GCSC_173:1460158..1459734 (- strand)
ATGAAGTCGTTTGCTGTCCTCCTTGCTGCCACCCTGGCCATGGCTTCGCCCATAAAGAGAGAGCTCGGTGGAGTAAGTGA
TCGCTTCAATGTCAACGTCTGGTAGGACCAATCCGCTGACCAGTTTTGCTTCAGGTCCTTCTCTGCAGCGGTGTCAACGC
TACCGGCTCCTGCGAGTATGCCGTCCACCCGCTCAAGACATGCATCAACACACCAGTGTCGCTCAACGGCACGACCAACA
CCTTCGCAGTGGACGGCGAAGCGTTTGAGTGCTACCCGTATGTCCAGAAATGCGGCGGCATCTGCACCTCGCCAGAAGGC
TGCACACTAGGCGCCATCGACTTTGGCTACGCGCACAAGTACAACCTGAGCGCGGTGGGCTGGGGAACCCTGATGGGTTC
GTATGAATGTCGCGCGAAGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62