GenePrediction:GLEAN_5709 Details

Name: GLEAN_5709
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1453954..1452753 (- strand)
Length: 1202
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1453954..1453754 (- strand)
Length: 201
Type: CDS
Source: GLEAN
Position: GCSC_173:1453687..1453270 (- strand)
Length: 418
Type: CDS
Source: GLEAN
Position: GCSC_173:1453174..1452753 (- strand)
Length: 422
>GLEAN_5709 class=GenePrediction position=GCSC_173:1453954..1452753 (- strand)
ATGCCTGCTGGGTTGGGTTGCATTGCCGACATCGACTTCTTGTCCGACTTTCTGCTGCCGTCAGCACATTGCCAGCGCGT
CTACGCCGTACGTCGTCCCGCGCGCTCTTCGTCCGTATCGTGCACCGTACGCAGTACCGCGTATTTCTTCTCGTCTCGCC
AGACCCGGTTCCCCGTCTCGAGTCCCGCACGCGAAACCATGGTCAGTTCTCCACAGCCAGGGCAGAAATCCAGCGCGCCG
CCCGTCTTCTGACTCGTTTAAATGCAGGCCATGCCCGCGGGCTACAAGCCGTCGCCCCTGGGCTACGGCTCTCCACGCAG
CTCCCCCTTTCGCAGGCCCGAGTCGCCCGTGTCGCCCACACCGCTCAAAGGCACACCTGGAGGCACAGCGACGTCGCCGA
CCGGAAGCTGGGCTTCGAGGAACCAGATACCCACGTCCACGTCCACGCCTACACCCACGCAGCCGGCCGTCTCAGCCCCG
ATCGGCGGCTCCTCCTCCCTCTTCTCGTCCACACCGCCGGCATCGTCGTGGCCAGCCCCAGCGTCGGCCATGTCCCAGAG
CACGGCGCTGTCGCAGCTGCTGCCTGCACAGGTGCGCGCGCTGCGCGAGGTCTTCCAGATCCTTGACCGCGACAGCGACG
GCATGGTCAACCGAGAGGACGTGGTCGACATGCTGAACCAGCTGGGTGCGTTTTTTCCTTTTTTTTTTTCTTCTTCGTTT
CCTTTTTCTTTTTTTTCAACCCCGTAATTTGGCTTCGATCCCCTAACCCGAACAACCTAGGCCTTCCTTCCAAACCGGCC
GATGTGTCCCCGTTCTTCCCACCGGCATCGCCCCAGACGATCGCCATGGGCTCGTTCCTCAACTCGCTGGCAGCGGCTCT
GGCGGCCATGTCCCCGAGCGCCGAGCTGCTGTCGGCGCTGTCGGCCTTTGACGAGGACGACAGCGGCCAGGTCGACCTGG
CCGAGCTGCGCGACGCCCTGCTGCACACGGTCCCGGAACCGGGCGAGCGGCAGCTGACCGAGGCTGAGATCAACCAGGTT
GTGCAGGGCTTCACCGGCCGCCGGGCCTTTACGGCCAAGAGCAAACCGGGACCGAGCTTCGGCAAGCGCGGCGAGGTGTT
CCGCTACCAGGACTTTGTCCAGTCGATCGCCGGCGGCGCACCGGGCAACACGGCCGAGACTGAGGCGACGAGAGAGGCAT
AG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62