GenePrediction:GLEAN_570 Details

Name: GLEAN_570
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:683344..684890 (+ strand)
Length: 1547
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:683344..683647 (+ strand)
Length: 304
Type: CDS
Source: GLEAN
Position: GCSC_97:683773..684487 (+ strand)
Length: 715
Type: CDS
Source: GLEAN
Position: GCSC_97:684854..684890 (+ strand)
Length: 37
>GLEAN_570 class=GenePrediction position=GCSC_97:683344..684890 (+ strand)
ATGCGCCACGTGTGTGGCTCAACTGCACCTCGACATCGAGGTCCTGGACTGCGTGGCTGCACCGGCGACCCAGGGTCGGC
GGTGCACCACACGGCATGCCAGAAGATACTTGACGAGGCCGGCATCAGCAATATGCATGTCGAGGTGTTCGAAACGAGTG
TTGTCTCCCTTTCTGGTGGTACTGCTGCCCTCCACCGTGCATTCGAGCCAAAGTACAACGCGTTTCACCTCACGAGGAGG
CGAGATGTTGTTCCTGAGATTACGCCTGCCAACAAGGCCATGATGCCATTCTTGCCTTTACCCGGTCAGTGCATCCAACA
AGTTCCCCAACACCAGCCAGAACAGCCAGGACAGCTTAGCTAACAAATCCAGCACAATCTTTCTCCACTGGAACATTTTG
GCGGTCTTAGCTGCAACCTGCAACTGTAGCCGCCGACGGCTCACGCCAGCCAGACCAGAAAACTCATGCTTTGACCTCCC
GACATGTCGCTGTGCGAACCCGTCACAACCACGACGAGTGCTACATTGAGCCAAGCGACACGAATGGCCTAATACATATT
GCTTGGGGCGCAACAAATCGCTTTCTCGGTGAGCTTCGCAATCTCGAACACTGTCGCTCGGAAATGAACAGATGCATGTG
GCCCCTCCAGAAGTTGCATTACGAGGACACTGCCTCAAAGGCGGATGAAGAGGCGCTTGCTCTCCTCGAGAGTTGCGAAA
ACACATACCTCGGTCGTGTCACAGATCTGATAGGAAATGCATCAGAGCTCAGCCTGGACGCACAGGAGCGACGTGTCGGA
CAATTCGCATTTGCAGGAAAGCATGGTCTGAACGACGATGGCGGCTGGAGTGATTGGGCTTTGGTTGCGCTTGACAAGGC
CCACGAGATGGAGAGGAGCGATGTTAAGGACAGCAAGGACGGTGGCGGGGACGACAGCAATGACGCCGAAAATCTTTTTG
GATCGAACCAGGTCTCCATGGACGACTTGCTTTCGCGAAAACGCGGCCATTTGTCTGTGGTTCTTGGCCTATCTGACGAC
ATTCCCATCTTCCACAAAATGGACACTCACGGCTTCGTGCATTTTCAGCTCCCCGCTGCTGCCTATTCTGCCCAGCCCCC
ACCTTCTCCTTCCAGAAAAGTCCGGTGCGTTTTCGAGCAAGGGGCACAATCCGGCCTCAAGGTAGGAATGCTGAGTGCGC
TGGAAGCAATGGTACGGACGGACTCTAACTACCTTGAAAATCCATTTGCTATACCAACACCAGACATTACCTGGCATTAC
CAACAGCAAGTGCAATCAGACACGCAGACCTGGCAAGCCACCCAGCCAGCCAACAATGTCCCCCCCTCACAGGAACTGCC
ATATTATATCACTAATGAAAGTGTTAAGGTTCCGAAATTATTAATTGACCAACCTTTTCCCTAAGCCTGCCAAATTTTCC
AACCATCGATGCCAACATCCCCAGACTCTTGCACACTCTAACCTGGATTCACACTTTCCTTGCCGCACAGTCCAAACGCA
TCCCAAAGAGGTACCACACTGCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62