GenePrediction:GLEAN_5710 Details

Name: GLEAN_5710
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1451222..1448759 (- strand)
Length: 2464
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1451222..1450301 (- strand)
Length: 922
Type: CDS
Source: GLEAN
Position: GCSC_173:1450231..1449070 (- strand)
Length: 1162
Type: CDS
Source: GLEAN
Position: GCSC_173:1449017..1448759 (- strand)
Length: 259
>GLEAN_5710 class=GenePrediction position=GCSC_173:1451222..1448759 (- strand)
ATGAAGAAGTTTTTTGGAAAACCCAAAAACCACGCCGCCAACGTCTCTTCCTCGTCCGACGCCGCATCTGGCGCACACCA
CTGCGAAGACGACCCAGTCTACTTGCCTTCGCCCGTCCGGTCAGAACCAGCCTCGCCGCGAATTAGCAGGTCGCCCACGA
AGCACTATTCTGCCTTGTCTTCGTCGCCTACCAAGACCACAGCCTCCTCGTCTCCGTCCGTCTCCGCCACCATCTCGTCG
CGGCCGCGGCCCACGTCGCCTTCCCAGCCGCCCCAGCTGAAGAAGAGCAGCTCTGCGTCGTCCTCGTCGACCCGTCGTCA
TCCCTCTTCGCGCCACCACGTCTCGGCCACGGTCGATCTGAATCCTCTGAGTCCTCTGAGTCCTCTGAGTCCTCTGAGTC
CTTCATCGTCTCGCCGCAAGAAGCCCGACCCCTCCGCCACCCACCCGCTCAACCTACCGCCAGAGGAACGCAGCAAGCGC
CTGTCCCACCTGTCGTCGGTGCCTATCGCCCGCGCTTCGTCTCTGGACACGGACAGGGACCTCACGCCCGGCCTTGCCTC
TGATACGGCCAGCCGTCCGTCCTCGCCTCCGCCGTCTTACGAGTCTGTGTCCCCCTCGCCGCCGAAGCGGTCGTTCAGGT
CGAGACAGCAGCGATCACAGTCGCCCCCTCAGATGTCCTCGCCCCCAATGCAGTCGTCCCCGTTGCCGGACGCCGCCGCT
GGCGCCGCTTCTGCGGCTGCTGCACCTGTGCCGGCTGCCAATGGCTCCGCAGCCAACGGTGCTGCTGAGAGCGTGCCCGT
GCCCCCACCCCACAAGACCCCGGCCTCCTCGGCCATCGACGAGGCTGAGGCTTTTAAGAATGCCGGCAACTCATTCTTCA
AGGAAAAGAACTTTCCGCGTGCCATTGCAGAGTACACAAAGGGTATGTACACGTGTTGATGCAATGTCGTGCCTCGTGTG
TCTCGTGTCTGTCGTGCTAACTGTCGTGCAGCTGTCAACCTGCAGCCACTCTCGGCCACGTACCTGAGCAACCGTGCAGC
GGCGTTCATGTCGGCCGGCAACTACTCGGCCGCCCTGGACGACTGCCAGCGGGCTGTCGAGCTGGACTCTCACAACGCCA
AGATCCTGCTGCGGCTGGCGCGGATCTATGCCAGCCTCGGCCAGCCCGAGGATGCGGTGCTCACGTTTGGCCGCATCCAG
CCACCGCCATCGGCCAAGGACACGGCGGCGGCCAAGGAGATGCTGCAGCACGTCAACGCGGCGCGCGACGCCCTGAAGAA
CGGCACGGCCGGCTCTATGGTGCTGCATGCCCTCGACATGGCCACGCGGCTGCTCGGTCCGGGCGCCCTGCAGCCGCGTA
AGTGGCAGCTGATGCGCGGTGAGGCCTACCTCAAGATGGGCGGCGAGAACAACATTGGCGAGGCGGCCAACATTGCCATC
TCGCTGCTGCGCTTCAACAACAAGGACCCCGAAGCCATCATCCTGCGCGGCCGCGCGCTGTACGCCCAGGGCGACAACGT
GCAGGCCGAGCGGCACTTCCGTCGCGCCATCGAGATGGACCCGGACCTGAAGGAGGCCATCAAGTGGCTGCGCATCGTCC
AGAAGCTCGACCGCATGAAGGAGGACGGCAACAGGGAGTACAAGGCTGGCCGGTGGCAGTCGGCCATTGAGAAGTACACG
GCGGCACTGGCGGTCGATCCCAGCAACCGCAGCATCAACGCAAAGCTGCTGCAGAACCGCGCGCTCTGCAACCTCAAGCT
GAAGCTGTACGACGCCGCCATCGCCGACTGCGACGCCGCCGTGACGCTGGACCCGCAGTACGCCAAGGCACGGCGGACCA
AGGCCAACGCTTACGGCCAGGCCGAGCGCTGGGAGGATGCGGTGCGTGAGTGGAAGGCCCTGCAGGAGCGGGAGCCCGAG
GACCGCACGCTGGCCAAGGAACTGCGGCGGGCCGAGCTGGAGCTGAAGAAGAGCCAGCGCAAGGACTACTACAAGATTCT
CGGTGTCGCCAAGGACGCCGACGAGAAGGAGATCAAGAAGGCCTACCGGAAGCTGGCCGTCATCCACCACCCGGACAAGA
ACCCGGGCGACGAGCAGGCCGAGGCCCGCTTCAAGGACGTGGCCGAAGCCTACGAGACTCTGAGCGACCCACAGTATGTC
ACGTGATACTTTCTTTGGCATGTCCCATCAACTAACCATCGGCAGGAAGCGTGCGCGCTACGACAGCGGCGAGGACCTAG
TCGATCCGTCCGAGATGTTTGGCGGTGGCGGCGGCATGCATGGCGGCATCGACCCGGAGATCCTGTTTAGCATGATGGGC
GGCCAGGGCGGTGGTGGCGGCGGCTTTGGTGGTGGAGGCTTCGGCGGCGGCTTTCCCGGTGGTGGTGGCGGCGGCGGCTT
CCACTTCAACCAGTCGGGTGGCTCCCGGCAGCGAGGCTTCCCGGGCGGCTTCCAGTTCCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62