GenePrediction:GLEAN_5711 Details

Name: GLEAN_5711
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1447566..1445172 (- strand)
Length: 2395
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1447566..1447222 (- strand)
Length: 345
Type: CDS
Source: GLEAN
Position: GCSC_173:1447164..1445496 (- strand)
Length: 1669
Type: CDS
Source: GLEAN
Position: GCSC_173:1445329..1445172 (- strand)
Length: 158
>GLEAN_5711 class=GenePrediction position=GCSC_173:1447566..1445172 (- strand)
ATGAGCTCTTCGTATGCGTACGATGAGACCGGCCAGTTGTGGCCGTTCTTCGCCTTCACGCTGTCGACCATTATCACGGT
CCCGCTCAGCTACATCCTCGTCAGCCGCGTGGGCAACCCGGCGGCGGCGTTCCCTCGCATCCAGACGGACTACCGGCCGC
CGCAGGCCAGCATCATCGATGCGGAGCGCGCAAAGTACCGTCGCAAGCAGCGGCGCATCGGGTTGATTTTGGCCGTCGTG
GCCGGTTGGGCTGTGATGGCCTACACGATGTACCTGATCTCCATTGCCGAAGCGCCCGAGGAGCAGCGCGTCTGGAACCC
TTACGACATTCTCGGCATCGCCGATGTAGGTGCAACGGGACCGACGAAGCACTGGCCGCTCTCTTGCTAACCCGTTGTCT
AGTCTGCCACCGAGAAGACGATCAAGCGGACGTACAAGCTGCTGTCGCTCAAGTTTCACCCCGACAAGATCAAGCCGGAC
GCAGCCAAGAACGAGACGCTGGAGATGCTCAATGACCGGTACGTGGAGATCTCCAAGGCGTACCAGGCGCTCACGGACGC
GGAGGTGCGCAACAACTACATCCAGTACGGCCACCCGGACGGCAAGCAGACAACGAGCATTGGGATTGCACTGCCGCGGC
TCATGGTAACGGAGCCATACGGCAAGTACGTGGTACTGTTCTACTTTCTGCTCTTTGGTGTGCTGCTGCCGTACGTTGTC
GGCTCGTGGTGGTACGGCACGCAGAGCCGGTCCAAGGAGGGCGTGCTGATGGAGAGTGCCAACCGGCTGTTCCACGAGTA
CGCCGACGACATTGACGAGGCGGCCTTGATTGCGGCGCTCAGCAACGGAAAGGAGTTTGAGAAGCTGCTGGCGGGCGACA
AGGCCGAGTCGGGGCTGGCGACGATCGAGACGCGCATCACGGCGCCGGTGCCAGCCTCAGACGCGGAGAAGACGGAGGGC
AGCAGCGACGAGGAGACGGCAAAGGCAGTGCAGACGATTGCTGGGCTGTCAGCAGCGGACCGGGAGAGGCTGGACAACCT
GGACAGCGGCAGCCGGCGCAAGGTGCTGGCGCTACTGTGGGCCTACCTGGGGCGAGTCGATCTGGGCGACGGGGTGCTAG
AGAAGAGCAAGTTCGAGGTAGCACCGGTGGCGAACGCGCTGACGCGGTCGTTCACGGCGATTGCGCTGGCGTACGGCAAC
ACGACGCCGGTGCTGGCGTCGATGGCGGCAGGGCAGCTGATCATGCAGGCGCTGCCGCCGAAAGCATCGCCGCTGCTGCA
GCTGCCTCACGTGACGGCAGCGGTGGCACGGGCGATTGAAGGCGGCGACGCGACGGTGCACATGTCGGTGCAGCAGCTGA
TGGACCTGCCGGAGTCGAAGCGGCGGCGGCTGGCGGTGGGAGCAGACCGGCTGAGCGCGACGCAGTTTGAGCAGGCGGTC
GAGGTGGCGCGCCAGCTGCCGTATCTGCGGGTAGCCAAGGCTTTCTTCAAGGTGACGGGCGAGAAGCACATCATCCCGTC
GTCGCTGGTCAGTCTGGTGGTCAAGGCCCGGTTTATCCCACCGGGCTTTGCGGCTTCGGCGCCGGCGGTCAGCGAGGCCG
ATCTGCTGGACGTGGACCCGGCCGAAGACGACCTGGACGCGTTGCTGGGGCGCAAGCGGCCGGTCGGCAAGAACCATGAC
GGCAGCCCGATCATGGCAGACCTGGGTCAGGACCAGCCGCTGCTGGCACCGCTGGCCTACGCGCCGTATTACGGCCGGGA
CCACTCGCCGCGCTGGCAGGTCTTCTTGACGGACTCGAAGCAGGGCAAGATGGTGGTACCACCCTTTACCTTTACGCAGT
TCGACAAGCCGCTCTTTGAGGCCGACGGACGCACGCCGACGTTTGCGGTGCAGACGCTCAAGGCCCAGTTTGTGGCGCCG
CAGGAGGCCGGCCAGTACACGTTTGCGCTGCACGTGGTGTGCGACTGCTACGTCGGCTTCGACACCAAGACGGAGGTGAT
GTTGGTGGTGGAGGACGCCAGCCGGGCGGCGGAGATGACGGCCGAGGACGACATTAGCGAGCCAGACGAGGGTGAGTGAT
TGTGTGGGACTTGGTCTTTTTTTTTCTTCCTTCTTCTTTCTTCCTTCTTCTTTCTTCCTTCTCCTTTCTTCCTTCTCCTT
TCTTTCTTCCTTCTCCTTCTACCCTCTCCTTCTTGCTTTCTCCTTTTCTCTCCCCCCTTCCATCGCTAACTCTACAGACT
CTCTGGCTGGAATCATGAGCGCGGCAAAAGGAATGCCACAGCCGGCCAAGAAACGCACGGCCGCAGACGAGGACGACGAG
GACGACGAGAGCGGGACCGAGGAAGAGGCTGACGACACAAGCGACACAAACACAGACACGGAGCCGGAAGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62