GenePrediction:GLEAN_5712 Details

Name: GLEAN_5712
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1443894..1442180 (- strand)
Length: 1715
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1443894..1443810 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_173:1443738..1442180 (- strand)
Length: 1559
>GLEAN_5712 class=GenePrediction position=GCSC_173:1443894..1442180 (- strand)
ATGAAGCGAAAGGCGGAAGAAGATCTGGTCTCACAGAGGACGGCGCCATTTGTCCGAACAGACGGAAGTACAGCACAATT
CAAAGGTAGGCAGTCCCACAGACGATGTCGATGGACGTTATCGATGAGATGACGAGATGCTGACGTTTGGATGCAGGTCC
TGCGGCACCAGAGCCAGAGGATGGTGTTCACGACGGGTCGACGGTCGGCTCGCTCGACGACGGGCAGACCGACCAGACGG
ACAGGGCGCCATCGACAACGCCGGTGACGACGGCCGTGTCAACAGCCTCACGGCGGTTTCCGTCGGACCTCAAGACAATC
AAGTGCACGTGGCCGGACTGCACGAAGACGTTTAACCGGCCAGCGCGGCTGACGGCACACCTGCGGTCGCACAACAACGA
CCGGCCCTTTCGCTGCGCTGACTGTGCCAAGACGTATATGGAGGAGAAGCACCTGCGGCAGCACATCAAAGGCTCGCACA
GCCAGGAGCGTCGCTATGTCTGTGAGGCGTGCAGCCGGGCCTTTCTGACGGCTACCCGGCTGCGTCGCCACGCTGCCGTG
CACGAGGGCCAGGACCGTTTCCGCTGCCGCGGCCACGACGCCGCCTGCACCCGCACCTTCCGCAAGCACCAGACGCTGCA
GCGGCACATCCGCGTCGACCATCTGGGACAGCCGGCCTTTGCCTGCAGTCGGGACATCGACGGGTCTGCGTCTGGCTGCG
GCGCCCTGTTTGAGAGTGCTGGCGCCCTGCGGCGACACGTGGCCCGCGAGCACGGCACGGCCAAGTACTGGTGCGAGGAG
TGTCTGGGCGAGGAGGATGCGGACAGCAGCACACTCCCCCCGAAAGCCGGATTCGCCACCAAGGTCCTGCTCGAGGCGCA
CATGCGCCAGGATCACGTCAGCTGTCTCTTCTGTGATGTTCGCTGCGCCGGCCCGGCCGCTCTGCACCGTCACATTGACA
TGTACCACTCGGGCAAGTCGCTGGCCGACCGCAAGACCACCGTCTGTCCGCACGACCGCTGCGGCAAGACCTTTACGCGG
CGCGCCAACCTCAACGTGCACGTCCGCGCCGTCCACGAGGGCCTCCGGTTTGTGTGCGGCGACGTCGACGCGCTGAACAG
CTTGACCGGCGAGGACGAGCAGCCCGGTCCGGAAGACCCCCAACTGGCCCTCTGGGACGCCCGGGCCAATGGCTGCGGCC
GCGGCTTCGTGTCTAAGCGGAAACTCGAGGAACACGTCCGGTACGTGCATCTCCGACACGAGCGGCCGCCACCGATGGTC
GTGACAACGCCCGGAAATCTGCTCGCTTCCGACGCCGGTCAGCCCGCCCCTGTCGCCCTCCTCGACGACCTCGCCGGCAT
CCGGCGCACGCTCGCCTGTCCGCTGGCTGGCTGTGCTGCCCGTTTTGTCCGCCATCACGACCTGCATGTGCACCAGCAGC
AGAAACACGCAGATACTGGCCTCGACATCGACGGCGACCCGCTGCTCATGCTCTCTAGCGCTGGCAACGACCTCGGTCAA
GACGGACTCTATCTCAACACGAACCCCGACCCAGACGACAGCTCCAACATGTTGGACATGTACCTCGACCTCGGCCTCAC
ACCGCCGCTGGAAGATGGCGCTGTACCGGCCGATGAGGGCCCCAATGGCAGATGGACGAGGCTGAGATGCGTCGTCTCAT
CGGCGATAATTACAACAGCAACGACGGGTTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62