GenePrediction:GLEAN_5713 Details

Name: GLEAN_5713
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1439203..1437195 (- strand)
Length: 2009
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1439203..1438729 (- strand)
Length: 475
Type: CDS
Source: GLEAN
Position: GCSC_173:1438646..1438129 (- strand)
Length: 518
Type: CDS
Source: GLEAN
Position: GCSC_173:1438075..1437951 (- strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_173:1437889..1437594 (- strand)
Length: 296
Type: CDS
Source: GLEAN
Position: GCSC_173:1437536..1437435 (- strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_173:1437382..1437195 (- strand)
Length: 188
>GLEAN_5713 class=GenePrediction position=GCSC_173:1439203..1437195 (- strand)
ATGATGGAAAACGCTACCACCGTGCAGACGCTCCTGGAGGTCGCGTCCAAGGACGTCGATGGCTTCCCTGCCCTGACTGC
AGCCTTTGCCATTGGCACGCTTCTGCATCTGTTTGCCTTCCGCCTGGGCGAATGGGACCTGGCCACGGCCAAGATCATCC
CCGGCTTTGTCCTGGCCTTTGTCGCCACTGCGGCCAGCATCGCCTTTCTGCAGCAGGGCAGCGAGCTGAGCCTCGTCCTT
GGCCATCTCGCTGCCGCGTCCAAGACGGCGCTACAGCTTCTCGCCGGCGTGATTGCCGGCACATATGCGAGCATCCTCGT
GTACCGCGTCTTCTTTCACCGGCTCAACCACTTTCCGGGTCCGTTTCCGGCCCGCATCTCAAACCTTTGGATCTCCAGCA
AGATCATGCCCCGAATGGAGCTGCACAAGGATGTTCAGATTCTGCATCAGAAATACGGTGACATCGTTCGTCTGGGTGAG
TCGTTTCTGTCTGTTTACTTGATTGCTACGTGGTATTTTTTTTCTTTCTTCCTTCTAACTGCCATCGCTCCTCACAGGAC
CCACGGAGCTCTCGATCAACAATTCCAAGGCCATTGAGATCCTGCACGCCAAGCATTCCACCTGCACCAAGGGCCCCTTT
TACGGGCTGCAGCAGCCGATGGAGTCGCTGCTGATGGTCCGCAACAAGAAGGACCACGCTCGCCGCAGAAAGGTGTGGGA
CCGCGGCTTCAACGCCAAGGCCCTGCACGACTACGAGCCACGTGTGGCCAGATACACGGACCAGCTGCTCGAGCAGATCG
ACGCTCACGTCGGTCAGACCTTCAACCTGGCCGACTGGTTCAACTTTTACAGCTTCGACGTCATGGGCGACCTCTCCTTC
GGCAAGAGCTTCAACATGCTCCAGCATGGCGTGCGCCACTACTTTATGAAGTCGCTGCACTCGGACATGGACAACCTCGG
CCTGTTCAGCCACTTGCTCTGGCTGTTCCCCATCTTCAAGGCCACGCCGATCCTCAACACCGAGCACCACCGCTTCTGGG
CCTTTGTCAGGACCCAGGTGCACGAGCGAATGGAGGTGCGTCTGCATGCTGGCAAAACAGACAAATCAAGGCTAATCCCG
TGCAACAGAACAAGCCAGACCATCCCGACGTCCTCTCGTGGCTGATTGACGAATATGAGTCTCTTGAGAAGCCGACGCGC
CAAGACCTGCTCAACCTGTACGGGGATGCATATCTGATCATCGTGGCTGGAAGGTAAGGCGCGCGAGATGCACCATCATC
GATCTTCCCTCTCCTTCTGCTGACACTGCCGCAGTGACACAACTGCTGTGGCTCTGACCAGCATGTTCTTCGAGCTGGCT
TGCCACCCTGGAATCGTCGAGAAGCTGCGGGAAGAGGTTGACGGATATTACCGCCAGCACGACAAGCCGGACCCATTGTC
CCTGGGCAAGCTCCCGTATCTGCAGGCCTGTGTGGACGAGTCGTTGCGCCTGCACCCAGCCGTGCCGTCTGGCCTCCAAC
GTATCACGCCTCCGGAAGGCGTGCAGATTGATGACATCTTCATCCCGGGCAACACCATCGTCCAGGTCCCGACGTATACT
GCCTTCCGTGGTACTTTTGTCCCTTCCGAAGGACAATGAGAAGGGTCGGCTGCTGACCGATACCAAGACGAGAGAAACTT
TGCCAGCCCCAATGACTTCATCCCCGAACGCTGGACAACGCAGCCCGAGCTGGTCCGCGATATGTCGGCCTGGGTGCCAT
TTTCAACAGGTTCGTGTAAACGTCTCATCTCCTGTGACACTGTTTTGCTGAACGTCTCCAGGTCGGACCTCCTGCGTAGG
CAAGCAGCTCGGACTCATGGAGATCCGCTATGTGGCCAGCCAGATTGTCCGCAAGTACGACTTTTCTTTTGCACCTGGAC
AGACGAAGGAAGCCTTTATAAACGGCCAGAAGGATGCCTTCATTCTGTCTCTACCGGCCCTCAATGTGGTCCTTACTCGG
AGGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62