GenePrediction:GLEAN_5715 Details

Name: GLEAN_5715
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1429345..1427438 (- strand)
Length: 1908
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1429345..1428913 (- strand)
Length: 433
Type: CDS
Source: GLEAN
Position: GCSC_173:1428836..1428796 (- strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_173:1428694..1427438 (- strand)
Length: 1257
>GLEAN_5715 class=GenePrediction position=GCSC_173:1429345..1427438 (- strand)
ATGTTTCAAGACGTCCAATTCTCGGCCCCCTTCCTCCAGCTCTACAAATCCCGACGCAGCAGCCTACGACCTCCCTCTGC
CCCTGTTCCGCCCGGCGATGGGCGAATCGCCATGGACGCGGCAACGGTGACCAGCTGCCAGGCGTCCGCCGACAGCGGCT
CCAACAGCAACAACACATCATCGCTACGTCGATCCAAGACAGGAAAAGATGCAGCAGCAGCAGCAGCATCACGACCACGA
CTACCACCAGCTGAGGCGGGCACGCGGCCAGCGGGCGACTCCCCGGCCATCCAGCAGCTGCGCAAGGTGATTCGCTACAA
GTACCGTCACGTCGCGGCCTACCACACGCAGTCACAACCGACGTGTCTCAGCACCGACAGTGCTACCTCACCCAGCTTCC
TGGGCTTTCGAAACCTGATGGTCATCGTTCTAGGTGAGTGGTGGCGGTGGAGATGATGAGTGTGATGGATGTCTGTGCTA
CTCGTGCACGTGCTGACACGACGCCGCAGTGGTCGGAAACCTCCGTTTGATGCTGGAGAACATCCAAAAGGTGAGACATT
CCCAGATATGCATCGGGCATTGGGCATCGAGCATCGAGCATTGGTTTTACTACCAGCGGGCCCCCGGATTTGGCTGACAG
TCGATCTACAGTACGGCGTTCTGATCTGCATACGCTGCCATGACTTCCGCCCACACGACGTGCTGCTGGGCCTCGTGCTG
TCCCTGGCCATCCCGCTCCACCTGCTGTTCGGCTACCTGATCGAGCTGGCGGCCGCACGCCAGGCACAGCTGTGGCGGCA
GCGACAAGCCAACAGCAAGCGGGCCAGGCTCGGCGGCCGCAGCCCAGACACGGGCACGTCCAGCCCAACCGAGGACGAGA
GCCGTCGGTTCCGGGCGATGTGGCACATGGTGGCATGGCTGCACGCAATCAACGTGACGCTCGCGCTGGCGGTAGCCTCG
TACGTGGTGTACTTCCATATCCACCACCCGCTGATCGGCACGCTGGCTGAGGTGCACGCGCTGGTGGTGTGGCTCAAGAC
GGCGTCGTACGCCTTCACGAACCGCGACCTGCGACACGCATACCTACACCCGGCCCGCGGCGAGCGCGAACAGCTACCAG
CGCTCTACGCGGCCTGTCCGTACCCACAGAACATCACGATGGGCAACCTGGTGTACTTTTGGTGCGCGCCGACGTTGGTG
TACCAGCCGATATACCCGCGCACCCCAGAGATTCGGTGGGTGTTTGTGGCCAAGCGGCTGGCCGAGGTGTTTGGGCTGGC
TGTGTTCATCTGGTTCTGCAGCGCGCAGTACGCGGCGCCGGTGCTGCAGAACTCGCTGGCCAAGATCGCGTCGCTGGACC
TGGCGGCCATTGCCGAACGGCTGCTCAAGCTGTCGACCATCTCGCTGGTCATCTGGCTGGCCGGCTTCCTGGCCCTCTTC
CAGTCGTTTCTCAACGCCCTGGCCGAGGTGACCCGCTTCGCCGACCGCGACTTTTACGAGGATTGGTGGAACAGCGCCAG
CCTCGGGGCCTATTGGCGCACCTGGAACAAGCCGGTCACACATTTCTTCCGCCGTCACGTCTACTCGCCGCTCATCGGCC
GCGGCTGGAGCCCCATGGCCGCGTCAGTCATGGTCTTTTTCGTCTCGGCCCTGCTGCACGAGCTGCTCGTCGGCGTGCCC
ACCCACAACATCATCGGCGTCGCCTTTCTTGGCATGTTCCTGCAGCTGCCGCTCATTGCCATCACCGCCCCGCTCGAGCA
CATGCACACGGCTGCTGGTCGCATGCTCGGCAACTGCCTCTTCTGGGTCTCCTTCACCGTCCTGGGTCAGCCCTTTGCTG
CCCTGATGTACTTTTATGCCTGGCAGGCCAAGTATGGCAGCGTGAGCCGCAAGCTGGCGGCGCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62