GenePrediction:GLEAN_5728 Details

Name: GLEAN_5728
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1355992..1353608 (- strand)
Length: 2385
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1355992..1355503 (- strand)
Length: 490
Type: CDS
Source: GLEAN
Position: GCSC_173:1355442..1353775 (- strand)
Length: 1668
Type: CDS
Source: GLEAN
Position: GCSC_173:1353708..1353608 (- strand)
Length: 101
>GLEAN_5728 class=GenePrediction position=GCSC_173:1355992..1353608 (- strand)
ATGGCTATGAAGACCACCGTTGCTGATGGCGTCCGCCGCAGCCTCCGACGACGTCACAAGATGCAGATGCTCAGTACCCT
GAAGATGCGCAAGCCCAAGTCAGCCACCATCCTGGCCGCAGCCAGGAAGGCAAAGAACGAGCGCCGCCAGGCCACTAAGA
AGCAACAACAACAGCAGCACGAAGGTGCAGGTGCCTTTGGCTGCTTTGCTGCCTCACCCGGCTCAACCACGTCGACGTGT
GAACATCCCAAGACGCCAATGGCCGATATACATGCGCAGACACTCTCCCTTCCGCAAGCTGGCAACACAGACGGTCAGCA
TTACATCTTCGGCCGCTACTTCGACGAGAACGATCGGTCAGCTGCCGATATCCTGGCCACCCTTTACTACAGCGGTGTCC
TGGATGGCAAGTCGCCGGCATCATCATGTCCCGGCATTCGGGGCGTATCTGGCTCTCCTCCCTTGTCTCCTCGGTCTGCT
CTCGCCATCAGTGAGTAGCCACACGCCTCTTTCTCTTACATACCTTCCTTCTTAGTCCTAACACAATCAGGCGGAGACAG
CGTCAAGGTCTGCGATGTGGCTCTGCCTAGCATGCGGCAGACGAGCATCATGCTGAAGAACTGGCACGCGGAGTCCCAGA
AGACCCGCGGCATCAGCACGGTGGATATCGTCCACGACGATAACACGGACGATATTGGTAGTATGGACGTCGATCCCGAC
ATGGACGGCGAGGCCGACTCAACCTACCCATCGACGCCAGAGCTGTCGTCTGGTGGCAGCAGCGCGCGTTCCTCCTTCTC
GACGGAGCCCGCCTCCGGCCACTGGAATTCCCTGTTCAAGGTCTCCGATGCCTCCAAGACCTGCAAGACCCCGTTTCCCA
TGTCTCCTTACTCGCTCGTCTCGCGCGGTATCTCTCCCGCGTCGCTGCCTCCTCCGGCATACACGGCTGCCGAGCTGAAT
ACAGCCAGCGAGCAGAAGACAGCCCCGACTTCCTCAACTGTCACCACTGCTTCTCCCTACAGCGTCCTGCAAAAACAACC
CTTCTCCACCTATGAGCCAAGCTACTTCTCCTCGGAGACCCGCTCTTCCACGGCTGATCGCGGCATGCCATCTCCGCCTC
AGTCTCCCACCTACTCCGGCCGGAGAACCGAATACTGCTTCCGCACTGGCCATGTTGCCTCGCCGCCACCCACCTATGAG
GCGGCCATGCAACAGCAGAAACAGCAACAGCAACAGCAAACCACCCCTTCTTTTCAGCAGACTTCTGTCCAGCAGCCCCC
CTTCCAACAGTATCAATTTCAAAATTACCACCAGCAACAACAACAACACCTTCCATCGCCTCATGATGCTTTTGCTGCTT
CCGCCTCGACTTCAACCCTCCGTCCGACCGACAACATTGCCACGACCGTTGTGACACTCCCCTCTGCCGGGTTTTCCCGA
GGGCCTCCGACGCCTATATCGCCTTTGGCTGGCCCCCACAATCTCTACAACACGCACAGCCACCAAACCCTTCCGGCAGC
GGCAACGTTGATGGCACCGACAATGGGCGCAACGCCTGGTGCCGACAGCAGCAAAAAGGAGCGGCAGCTCAGCCGTACAG
GCGGGCTATCTGGAAGGAAGTCTGGCGACACATCGGTGCCGCGGCCACATTGCAACGTCAAGTACGAGACGGCTGAGCTA
GACTTTATCATGTACCAGCGCTGCACCAAGAACAGGGCTTGGGATGATGTGACGGCCTCGTTCAACGCTGCTCTGCCGCG
CCTGCGCCAGTATGCTGAAATGGACTACCTGCGGATGAGCGGGGCCAACGGTGTCATGGGCAACCCAGTTGGCACGCCCG
ATGCCAAAGCTGTCATGGACCGCTACCGGCCGCGCCCAGAACGCACGACGCCAGGCCTGCAGGCATCTTACTATCGCCAG
AGACTGGCTCTGCCGCTGCTCGACGAGGCTGGCCGTCTTGTCTTTGACAAACAGACCGGTAAGCAGATCTTCACCGAGGT
CATGGTGCGTGACGACAAAAGCCGCAAGAAGATGCGGCGTCTGAACAACGGCGTTGGAGTGGCTGGAAGCAATGCCGGCA
GCAGCAGTGTTTCCGCTTCTCACACAGCTGGAAAGGACGATGCTCGCGTCCATTTGGTACTCTACTTCCCCGAGCGTGTG
GCCCACTACGACTACTGGTTCGTCACGGCCGAGGACAAGGCCCTTGCCCGGCAGCGAGGTAAGCCTTTCATCTACACATC
CATCTCTTGTCATCCTGAATTACCATACTGACCAATATCGCCAGCCTATGACCGCAATATGCAGCGTGCCCAGCGCGGCC
TTGCTGCCTGGCACCCTGGCAGCGATGACCCGGAGACGGGCATCCTCATCCGCAACAAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62