GenePrediction:GLEAN_5731 Details

Name: GLEAN_5731
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1337221..1335956 (- strand)
Length: 1266
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1337221..1336822 (- strand)
Length: 400
Type: CDS
Source: GLEAN
Position: GCSC_173:1336743..1336154 (- strand)
Length: 590
Type: CDS
Source: GLEAN
Position: GCSC_173:1336093..1335956 (- strand)
Length: 138
>GLEAN_5731 class=GenePrediction position=GCSC_173:1337221..1335956 (- strand)
ATGTCTGCTCAACAGGACATTTCGCCCAACGGCAACGATGCGGATCTTTCCGACCACATGAAGATGGATGACGAGCCGCG
TCTCGGCCCCGACGGCGAGATCATCCCCAAAACCGACGAAGAGTATGCCCAGACCCAGCTGACCCTGCGCGCGATTGTGT
CGTCCAAGGAGGCCGGCGTCATCATTGGCAAGGGAGGCAAGAACGTGGCAGACCTGCGTGACGAGACCGGAGTCAAGGCC
GGCGTCAGCAAGGTCGTCCAGGGCGTGCACGATCGCGTCCTCACGATCACTGGTGGCTGCGACGCCATCTCAAAGGCCTA
TGCTGTTGTTGCTCGTGCCCTTTTGGAGGGCGTTCCGACCATGGGAATGGGCGGGATACTCCAGGGCAACGGCACCCACC
GTAAGTTGCCACGTCGGATCGAGAAACACCAGCCGCACACTGTTGCCATCCCTTTGTTCGCTTGCTGACCGTCTGCAGCC
ATCAAGCTGCTCATCTCCCACAACCAGATGGGTACTGTCATCGGCCGCGGTGGCCTGAAGATCAAGCACATCCAGGATGT
GTCTGGCGTACGCATGGTGGCCCAGAAGGACATACTCCCGCAGTCCACCGAGCGCATCGTCGAAGTCCAGGGCACGCCAG
AGGGCATCCAGAAGGCCGTGTGGGAAATCTGCAAGTGCCTCGTCGATGACTGGCAGCGCGGCACCGGCACGGTCCTGTAC
AACCCCGTTGTACGCACACAGGGCACCTCGCCCACTCTCGGCAGCGGCAGCATCGCACCCACGTCCAACTACAACTCGGG
CGGCCGCTCCGAGTATGGCAACTCCCGTGTGACCCGCACTGGAAACGGTGCCGATTTCAGCAACGGCGCCTCGTCACGTC
CAAACAACCGGCGCTCCGACTCGGACGCGGCTGCCCGTGGCCCTCCCACACACGACGAACAGGGCAACGAGATTCAGACC
CAGAACATTAGCATCCCGGCAGACATGGTCGGCTGCATCATCGGCCGGGCCGGCAGCAAGATTAGCGAGATACGCAAGAC
GTCGGGCGCTCGCATTTCCATTGCAAAGGTAAGGAAGGATGGCTCTCCGAGGAGCTACACAATTGTGCAGCAGTGCTAAC
ACGCGCAGGCCCCGCACGATGAGACCGGCGAGAGAATGTTCACCATCATGGGCAGCGCCAAAGCGAACGAGACTGCACTT
TTCCTTCTGTACGAGAACCTCGAGGCCGAGAAGATGCGTCGGAGCCAGGCTGGACCGGCCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62