GenePrediction:GLEAN_5732 Details

Name: GLEAN_5732
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1334310..1332906 (- strand)
Length: 1405
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1334310..1334105 (- strand)
Length: 206
Type: CDS
Source: GLEAN
Position: GCSC_173:1334030..1333183 (- strand)
Length: 848
Type: CDS
Source: GLEAN
Position: GCSC_173:1333126..1332906 (- strand)
Length: 221
>GLEAN_5732 class=GenePrediction position=GCSC_173:1334310..1332906 (- strand)
ATGGCACGAACAAAGCAAGCGGCGCCCATTCAGCGCGAACCGACGTCCGAGTACGTGGGCAAGGAGGAGCGGGCGGCGGC
GCTACGATCGAAAAGCGAGAAAGCCAGCGGCCATGGTCGAAAAACAAACGAAACGGGCGAGGTGTCTGTGGCGGCTGCAG
GGATCCAGCAGGTGGTCATTGCCGTGGCCGGCATCTACGGGTCGTTGTAAGTGGTGCGAGAACAAGACAGGCGCGAGAAT
GGCAAGAGAGAGAGAGAGGGGCGAGACATGCTAATGCCAGGTTGCGGAACCACGACGACAGCCTGACGTGGGGCTATCTG
CAGGAGAAGCTGACGACGACAGCCCACGCGGCGCCGATGACGACAGCCAGCAGCAGCCGCAGCAGCGAGGTCTTCCACTT
CCCCGTCTTTCTCAACACGGTGCAGTCGGCCATGGCGGCCGTGACGGGGCTGCTGTACCTCTGGGCAGCGACGCCGCGTG
GCTGCTTGGTGCCGCCGATCGTGCCGTCGCTGCGGCTGCTGGGACCGCTGTTGCTGGTCGCGCTGACGTCCTCGCTGGCG
TCGCCCTTTGGCTATGCCGCGCTCGGCCACATCGACTACATCACGTACATCCTGGCCAAGTCGTGCAAGCTGCTGCCCGT
TATGTTTCTGCACGTGACCATCTTCCGTCGACGCTACCCGCTCTACAAGTATCTCGTCGTCGCGGCCGTGACGGCCGGCG
TAGCCGTCTTCACGCTGCACACCGGCAGCCGTCATGGCAAGTCGTCCTCGTCGGCCTCGGGCCAGCGCTCCTGGGGTCTT
CTCCTGCTGGGTGTCAACTTGCTCTTTGACGGCCTCACCAACAGCACTCAGGACTACATCTTCGATGCTTTCCGGCCCTT
CTCCGGCCCCCAGATGATGTGCGCCAACAGCTTGATGCAGACGGCCGTCACGGGCGCCTATCTGCTGGCTGTCAACCCGT
GGCTGGTGCACTCGGGCGTCGGCGCCTGGCTCGGCGCCGTCGACGAGTCTGCCGCGGCCACCGGAGGCGAGCTGGCCGCC
GCTCTCGCCTTCCTGCAGCGCCACCCGTCCGTCTGGCGTGACGTCCTCGGCTTTGCTGCCTGCGGTGCCGTCGGCCAGAT
CTTCATCTGTAGGCTTCTTCCCGATGCGCAAACGTTCTGTGACTACTTGCTAACCCGGCTGCAGTCTATGCCCTCTCCAC
CTTCTCCTCCGTCTTCCTTGTTACCGTCACCGTCACGCGCAAGATGTGCACAATGATCCTGTCCGTGGTGGCCTTTGGCC
ATCGGCTGTCGCACATGCAGTGGCTCGGCGTGGCGCTCGTCTTTGGCGGCATTGGCGTAGAGGCGCAGATTGCACGCTCA
GAGAAGATGAAGAAGCAGGCCCAGAAAACAGCCAAAGCTCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62