GenePrediction:GLEAN_5733 Details

Name: GLEAN_5733
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1322663..1318369 (- strand)
Length: 4295
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1322663..1321873 (- strand)
Length: 791
Type: CDS
Source: GLEAN
Position: GCSC_173:1321689..1320756 (- strand)
Length: 934
Type: CDS
Source: GLEAN
Position: GCSC_173:1320495..1318369 (- strand)
Length: 2127
>GLEAN_5733 class=GenePrediction position=GCSC_173:1322663..1318369 (- strand)
ATGGCTTCCGTCGCCATCGCCGGCCATTCTTTCGCTGCCAACACAGTGACCCCCCCACCACCAGCAACTCCGGCGACGAA
CAGGACGACGACGACAGCCGTGGCCGGAACAGCCTCTCCCGCCAGCAGGCGCTCTCCACCGAATTCCGCCCCTGTGGATA
GTGATGTGTCGCCAGCGCCATCTACATCGCCAGCCTCTACACAGATACAGTATCCACAGTCGAGGACAGATCCGCATCCA
GACCACCGGCTGCAGACGCCCAAGTCCCAGCAGACGCCAACCCATCATCCTCTGCACGCGCACCGACAGAACCACAACTC
GTCCAAGCTGCCGGCCTTCCGGTTCGCCGATTTGAGGAAGGACTCGCTGGTGCTGCCATCACGACCACACCACAGTCCAC
CGTCGCCTGTCTCGCCTGAGCCGCCCTACGATTCGGGGCTGCAGCAGCAACAGCAGAAGGTGGATGCACTGCAGGGGGCC
GACTCTCAGCAGAACCACTGCCAGTACGACCAGCAACAGCGCCACCAGCAGCCGACACCCCCTACTCCTCCCACTACAGC
AGACGCTAATTTTACCGCCCCCACCACTACATCGCGCTGTAATAGCGCTGGGAACGTGCACAACAACACTGTTTCGGCTA
CCCGCAGTGACTTTCCCCTTTCGCCCACATCTTCCTCCTCGGCGTCTGGCAACACCCGTCCGAGTCAGCCTGCACGATCC
CGCCCGTCGTCGTTTCAAAACCTGGCGCCGCCCCCGCCGCCGCACCAGCAGCAGTCTTTCTCGCCTTTCTCGTCTTCCTC
GTCTTCCTCCACGGCTGCCGCCGCCTGCTCGCACAGCACTACCACTACCACCACCACCAACGCCAAATCCGACCACAACA
GCACGCCCATTGCCACAATCGCCACCATCGCCACCACGACCAATAACATCACGACAACAACGCCGACGACTACGTCTGAC
GACCTCGCTGCCAGACGGCCTGCGTCATTTCCAAACTCTCCACCCACCGTCGTCGTCTCCGCTGTCAATACCACCCCTCT
CGCGTTCTCGTCCAGCCCAGTAACGGCCAGACTCCAGCGCACGCTGACGGACCCCATCCCGTCGAAATCGACATCGCCAT
CGCCATCGGCAGGCGCATCGACATCCGCATCGGCGGCGACCACGTCATCGTCCTCGCAGCCGCAGCCGCTTGCCTCGCTG
GGCAACGCAAAGACCCAGTCGCTGCACCGTCGCGCACCCGCCTCCTTCAGCTCCCACGGCCTCGAGACGTCACGCGGCCC
ACCCACCGCCTTCACCGCCAAGCGCATCCAGGCGGTGAACGTGCAGGCTGCTGCCGCCCACGCTGCTGCTACTGCCCAAG
GCTCTCGCCCCAGCGGTTCTGCGCCTACGACTACGCCTGCGCCAGAGGCCGCCACGGAGCGGGTCAAGAGCCAGCGCGAT
TCCGCGCTGTCGCCGAGCGAACCGTCTTCGCCACAACAGTCGGCTGATGACAAGCGAAAGCCCGCCACCATCACCTCCCG
GCCTCCCGTCTCGTTCCGTGCCCCCTGTTACGACAGCTCTTCGCCGCGCGGTGCCATCCCCCCCATCCGCTCCTTCCGCT
CCTCGGGCTCGCGAAAGAGCCTGGGCCTGGACATGAATTCCCGCCCTTTCGGAGACTTTAGCGACGCCGATTCTACCGAC
GCCGGTGGTCTGAGTCCGACGCAGCACGGTCGCTCCCTGCGTGCGCTCGAAGGCTTGACCGACGACGAGTGGACCCAGCG
CGCCTTTCACGACTCTACGTCTACGCGCTCAACACTGCCCGACACCGACACCGAAAACACGGCGGACATCTTCATGCGCA
TCGCACGGGAAGACACGAGGAACCGGTCCTCCGACGAGGATCGGCCCTCGGACAATCACAGCGTGGCAGTGAGTGAACCC
TCCCCTCCCGTTGCCGTCCCCCTTGTCATATTGTGTTTCACGACGCCACTTGTGTGTCTCGGAGGCGTGTGGGCGTTGCA
TCGGGACAATGGGTTGAAACGGGAAAATTTTTCCTGCTTGTCCCTCTTTTCACAGCACTAGTTTCACATCCCATTTTTTG
CGTATTAACATGGATTCTTGTGCAGGCACGCGCAACACAATCAACCTCGCAGCGGCGACCTTTTTCCGCCGCTGTTCCCT
CCCACCAGCCGGCTTCTCCGACCCAAGTTGCCCGCCGCCTTTCCGATCAGCGCGAGACAGCACGGTCTCGACGTGCCGGC
GAAGAGCTGGCGGTCCGGACCCACGCCTTTTCGCATGAGCTCAGCCAGCGTGCTCTGGCAAATGATCGGCTGACGTCCAG
TCGGGCCAGCGGGACCCAGAAGCCCGATCCCGTCCGGACAGCACGAACGGTCATCTCGTCGGCACGGCCGTCTCCGAGCA
CGCCGCGAGCGTCGGCCTTTTTCGATACGGCATCGGAAGTAGGCACGAGCTACGCCCGGAGACGACCGTCGACCGACAAC
AACAATAACAACAACGGCAGCACAGCACCGCCAGCACGGACGTCTTCCATCAAGCCATCTCTCGCATTTGCGCGCACATA
CAGCTCTTCACCACTCGTGCCGAAACATACGAGCGAACCGCAGCAACAAACCGCACACGAGCCGAGCCATGGGGTGGTCG
AGGGCACGGAGTCGTCGGGATCGACAGCGGCGCCGTCGACGGTCTGGGACGAGCTGGACGACCTGAAGTCACGCATGCGG
CGTCTAGAGCTGTCGGGCAAGATTCCACCGACGTCAGGTGCTGCCATGTCACGGGTGTCGGACGACCGGCCACGCACGGC
GACGACCAATGCAACGACAGTGTCGGCTTCACCCAAACGCGGAGCCAACAGCAGTGCTCAGGCAGATGCACGCAGCACGA
CGTCATCACAACTACACCACCAGCAGTCGCAACAGCAGCTTCTGTCGCTGTCGCTGCAACAGGGCGCGCAGCCATCCCAT
GCCAACCTCTTGACGGCTCTGCAGAAGGTCAAGGCACAGACGAGCGACGACGTGTACAAGGCCATGGAGGCCATGGCTGC
GGAGGCACTGGCGCTGGCGCAGATGGTGGGCGTGTCCGGGCAGCCAGGGCCGATCTCGAGTGGTGCCAGCACGATTGGAG
GCGGCGGCCCGGCGACGGTGACAGACCGACAGCTTCGGCGCAAGGCCGACAGCATATGCCGCAGCCTGACGGAGCTGTGT
CTGACGCTGAACGAGGAGGCGGTGCACAAGAAGACGGCGGCGACCACATCGGCTTCGACAGCCCTGACGACCATGACATC
GATGACAACCATGACAGGAGCGGCGTCCACAGCAGTGGCACCGGCGATATCGCAGACACACCTACAGGCAATTGGGTCTC
GCGAGGAGGCCGAGGCGATGGCGAGCCCGGCCACGAGCAGCAAGCCATTTTCACCGATGCTGCGACGGCCTACATTTGAT
GCGTTTAGTCCGTCGATACAGACGAGCCCGAAGGCGGTGTACCGGTTTGAGGGCCGGCGGGACGAGCGGCAGGACGAGCG
ACGGGCGTCGTTGATGATGCCGTCCTCGCTTGCGGGATCGCGGCAGTCGCTGGGGCCACCGTCGACGGCAGACAACGTGG
GGCGCAGGTCGTCGCTGTTGATCTCCCGGACACGGCGGGCGGTGACGGAAGAGCCGACGGACGACAGCCAAGGATCGGGA
CGCCGATCGTCGATCTTGCGAATGCGGCGAGCCGGCACGGAAGAGCCGGCGGAAGAGGGCGGACGCAAATCGTCGCTGCT
GCTGCGATCACGACGGGCAGTGATGATGAGCGTGGAGGACGACGACGACCAGGACAGCGGGATCCGGTCGGCGCGGTCGC
CAGCACGCATCATCACGGAGACGGCAGTATCAGCTTCGGGATCGCGACAGCCGAGGGAATATGCCGGGCGCGAATACCTG
ACGGCGCCGGGCGAGACCAGTCCGCTGGGCTCGTCGGCGCTGCCGCGACGACGACTGATTCCGTCGAGTCTCAGCTCACG
GCTGGTGTCGCCACAGCTGATGGCCATGACGGCAACATCCACGTCGTCACCGTCGTCGTCGTCGCAGGCGCTGCTCTCCA
GTCGGCGGTTCCTCGGACGGTCAGGCGGCGGCAATCGAGACGGCGGCAGCGGAACGCCAACCAAAACCAGCGAAGACCGG
GCGCAGCAGCGACAGCTCTCACTCGGCCAAACAGCCATGATGAACCGCACAAGCGTGTCTTCGCGACGGATGACCCGCGA
CACGGGCATCTCGAACATGCCCTCGGCGGCATCGCAGGTGGGCGGCTACCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62