GenePrediction:GLEAN_5735 Details

Name: GLEAN_5735
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1312605..1310179 (- strand)
Length: 2427
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1312605..1312296 (- strand)
Length: 310
Type: CDS
Source: GLEAN
Position: GCSC_173:1312242..1311672 (- strand)
Length: 571
Type: CDS
Source: GLEAN
Position: GCSC_173:1311289..1310179 (- strand)
Length: 1111
>GLEAN_5735 class=GenePrediction position=GCSC_173:1312605..1310179 (- strand)
ATGGGCGAAAAACGCCAGCAGAACGAGTATGCCGAGGCGGAGCCGATGGCCAAGAGGCCCAGAAGCGGTGGTTTCAGTAA
AGACCAGCATGCAAAGAAGCACACGGCCAAGCCGGACTCGTCGAGCTGGGCAAAGAAGCGGGCTCGTGCGATTGAGCGGC
GCATGCAGCGCAACCCCGACACGCTGCCGGCGAACGTGCAGCAGGACCTGGAGCGCGAGCTGATTGCGCTTCGGCAGCAG
CTGAACAGCCGGCAGGAGAAGAAGCAGCGGACGTACATGATCTCCAAGTACCACATGATTCGGTTTTTTGGTAAGCTTAC
CACGGGCTTGTCGAGCTGGCCGGGCATTTACTCACCTTTGCAGAACGGAAAAAGGCGATGCGTCTGGAGAAACAGCTGCG
GCGACGGCTTGCCGAATCGGACGACCCGATGGAGGTGGCAGCCATCAAGGCAGACCTGCACATTGCCGAGGTGGACCGGA
TGTACGCGACGTACTTTCCGTTTATGGAGCCCTACGTGAGCCTGTATGCGGCGAAGGAGGAAAAGGAGAAGGAGGAGAAG
GGTGGCAAGGGTGACGAGGACGACGAGGACGACGACAGTGAGGGCGGCGCAAAATCAAAGGCTGGCAAAACGGCTGGCAA
AAAGGCCGGCAAGAAGGCCAAGGGCGAGGACAAGGTGGAGGCCAAGGCTGACAGCAGTGCGACAAGCAAAGCGGCGCAGT
TGTTGCACGCGCCACGGCCACCGATCTGGGCCCTGGTTGAGACAGTGATGCAGTCCGGCGACATGAGGGAGCTGAAGCAG
CTACAGGAGCGGCAGCCGAAGAAGACGGCCGAGAAGGCAGGCAGCAAAACAGCGACGGGAGCGAAGGAGGAGAAGAGGGA
GGATAAGAAGGCCAAGGGCCAGGAGGATGATAGCGATGATGGTGGTTTCTTTGAGTAGGACTGATAGGCTAGAGTTTGAG
ACACGAACGAGTACTCTATACCCACACAAATATAGTAAGCCTTTTTGTTCTGTCTGCACGGACCTTTTGCGGCGTTAGGC
TTGCAGTGTTCAGCGAGGCGGAGCAGATGCGGAGAAGGAGCTGGAAGCTGCGATCGCCTGAGAGGTGCCTGCCAATTGCG
TCGGATTTAGGCCGGCTGCCTTGGAGTGGATTTTGCATCTCGAACTTTATATGTCGGCATTGTGCTCGACAGCAGTCGAC
AGAAGAACAGAGAACAGAACAGAGAACAGAACAGAGAACAGAACAAAGAACAGGAAAATAGAAGAAAAAGCGAAGAACAG
ACGGACAGAAAGACGAAAAAGGCCGACAACACGCAGCGCGATGTCATACAACCAGCTCCGGGCCTGGATCGAAGCCCAGG
AGGCCTTTGAGCGGCAGAATGGCAGTCCGGCGCCGCTGACGGACGAGCAGCGCCGGGCCATGGCGGTGCTGGTGCCGGCG
CCGATGGTTCTGCCGGCGGGCGACGGGGCGATGGAGGCGAGCACGGACTGGATCAGCCGTCTGATGCACTATGAGCAGTC
CAGACCGTACGACGCAGCCGGCAGCCGTGCCGAGTTCATCGAAGAGCCCATCGCCTCACGCGGCGGCGGTCCACCATACT
GGCGGTGCTGGTGTCGGCTGCCGCGCGAGGCGCCGTCGCAGCGATTCCCCGACGCAGACACCGTGGCAGCCGATCCGCAT
GCCGCCGTCTTCCTCCGCAAAAAGGACGCCAAGAAGTTTGCGGCCCAGTGTGCGGTCCGATGGCTGATGGCGCACCACTA
CATGCCGACAGCCGTCACGGGCAGCAGCCCACGGCCGCCGGTTTCGTCCACGTCCACAGCCGTCGCCAGACGACTGTCCT
CGCTGCCCCTTCCCGTGCCATCCACCTCTCCGCCTTCTCGTCGTCTCGTCCATCAGGCGCAGCAGCCAGACACGACAACG
ACGACTGCTGCTGCACTGCCGTCTCCCAAACAGATCCTACCAGCTTCCACCTCCACCTCCTCTTCCCTCCCACAGCCACT
GTCGTCCTCTCCCGACGAGGAGTCCACGCTCGCAGACTATCGCGCCCGTCTGTCTCAACCGGCTGACTCATCCGCCACCA
ACGCCAAGGTCTCGTCCATGGCCTCGTGGCAGTCGTCGTCGCCCTCCACCAAGCGCAGACGCGGCAGCGACGGCGACAGC
ACGTCCAACGTGCGCAGCCTCCAGGACTTGTGCCAGAAGCTGGGCATGGCCATGCCGGAACTCCGCGTGACCGCCTGCAG
GGGCCCCAATACCGGCTTCTTCGACGGCGTCGCCGTCTTTCTGCCGCAGAAGAACAGACCCGCTCCTGTGGTCCTCCCGA
CTGGCGTCGGCTCTGTCTCCATGGTTTACACCCGAGAGGCCACGAAGGAGAAGCTGGCCCAGAGCGTGCTTGCCCATCTG
GCTTCGGCTGCAGCCAAGGACCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62