GenePrediction:GLEAN_5736 Details

Name: GLEAN_5736
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1299729..1298579 (- strand)
Length: 1151
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1299729..1299664 (- strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_173:1299605..1299584 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_173:1299516..1299448 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_173:1299381..1298579 (- strand)
Length: 803
>GLEAN_5736 class=GenePrediction position=GCSC_173:1299729..1298579 (- strand)
ATGGCCGGGCCCAAATACCTCAGCGGAGACGCCGCTGCCATTGACGAGTTTCTTGACAAGTTTGATGTGAGGCTTCGCAC
CCACCCGCCCTGGATGGTCTTCTTGTTCTGACGTGTGCCTACAGACATTCCTGCTGGACTGTGATGGTGCGAACTGGCCT
GGTTGTTCTCTGGAAGCTCTACGAGCATGTTACTCATTGCTGTCGAATAACAGGCGTCCTGTGGTCCGGCGACCACGTAT
TCGAGGGCATCCCGGAGACGATTGAACTCCTCCGCAGCAAAGGTGGGCGATCTCTCTTTCCTTCTCCCTTCTTTTCTCTT
TATCCCCTTCTCCCCTCTGACACTACAGGCAAACGAACGGTCTTTGTGACCAACAACTCGACCAAGTCGCGCGCAGAGTA
CCATGCCAAGCTCGCGGCCAAGGGCATCCCATCGGACACGGACGACATATTCGGCTCGGCATACTCGGCAGCCATCTATA
TTTCACGCATCCTCAAGCTGAAGGCGCCGCGCAACAAGGTGTTTGTGCTGGGTGAAGCCGGCATCGAGGCAGAGCTGCGC
AGCGAGGGCATCCCGTACATCGGCGGGACGGACCCGGCGTTCCGGCGTCTGGGCATGGAGCCGGCTGACTTTGCAGCCGT
GGCAGACGGCTCCGGACTCGACCCAGATGTCGGTGTGGTGCTGGCCGGACTCGACTTCCACGTGACCTATCTGAAGCTGG
CCCACGCACACGCCTACCTGCTCGGCAACCACGACGTCGCCGGTGGACATGACGGCAAGGCACTGTTCCTAGCCACCAAC
ACGGACAGCACGTTGCCGATGAGCGGCAGCTTCTTCCCCGGCGCCGGCTCGGCTACGGTCGTGGCACTGTCCAACATGAC
GGGCCAGCAGCCGCTGGCCCTGGGTAAGCCCAGCCAGGCAATGATGGACGCCGTCGAGGGCAAGTTCCATCTAGACCGCT
CGCGCACCTGCATGATCGGCGACCGGCTCAACACGGACATCCAGTTCGGCGTGGAGGGCCGTCTGGGTGGCACACTGGCC
GTGCTGACTGGCGTCAGCAAGAAGGAGGACTGGGACAAGGCTGACGCTCCGGCCGTGCCTGCATTCTACGTCGACGCTCT
GAGCGATCTGCGCGGACCTGCGAAGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62