GenePrediction:GLEAN_5738 Details

Name: GLEAN_5738
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1285766..1284526 (- strand)
Length: 1241
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1285766..1285389 (- strand)
Length: 378
Type: CDS
Source: GLEAN
Position: GCSC_173:1285327..1285263 (- strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_173:1285207..1284526 (- strand)
Length: 682
>GLEAN_5738 class=GenePrediction position=GCSC_173:1285766..1284526 (- strand)
ATGGTGCTATACTCTCTGCCAACGGTCGAGGACTGTGCCAGCTTCTCTAATACTGTTGAGCCATATATCAACGAGTTCTG
GGAGCTGCCTGTTTCAATTATCACCCGTGTCGGCGTCTTCATCCGTGGTCAAGATGGCCCGACTCTGCTTGACTCATACG
TCAATACAAACCCGCTAGTTCTCGGGTTTGCGCTGTCTCTCTTAATGGGCTGCATATTCTTCGTCGTGTCAGAATTCAAC
GGCAACTATTCGCAGGTTGATCGCTGCTGGAGCCTGCTGCCAACACTTTACATTGCCCACTTCAATCTCTGGTCGCGGCT
GTCGGGCAGGCTAAGTCGTCGCCTAGATGTTGTTCTTTTCTCTAGCATAGTTTGGAGTGTAAGTCCGGAACAGGCCTCCC
GTCCGGACATGATCAGGATAAGTGTTGACTCGAAGACAGGCCCGGTTGACATATAATTATGCACGCAAAGGCGGCTATTC
CGTGGGCTCTGAGGATTACAGATGGTAAGGCATCCGTTCAGTCACGAAGCAATGTCTGATCTCATGCTAACCCTAATAGG
GCCATCGTCAAGAAAAACATACCAGCATGGTCATTTCGCTTGCTAAACTTGACATTCATTTCCTTTATCCAAAGTGTTCT
GCTTCTCGCGCTGGCCGCTCCCGCCTACACCATTCTTTTGGCAAGCGACATTGAGCAGAGCATGACGGCGGCCGACTGGG
CATTTGCTTCCGTGGAGATTGGCCTTGTCATCGTCCAGTGGTTCAGTGACGGACAACAATGGAACTACCAATCGGCCAAG
CGGCAGTATCAGCAATCTGCAAAGGTGCCTGCTGGGTTCACCCGAGCTGCCATGGATCGCGGTTTCATCGCTGAGGGTCT
TTGGGGCTACAGCCGGCACCCAAATTTTGCGGCCGAGCAGGCGATATGGCTTGTTCTATACCAATGGAGCTGCTATGCGA
CCAGCTCTCTCTACAACTGGGCTGGTGTAGGCTCAGCTGGCCTTGTCATGCTCTTCCAGTCCTCAACGTGGCTGACTGAG
TCAATCACGTCTGGAAAGTACCCCGAATACAAAGAATACCAGAAAAAAGTCGGCACATTTGTGCCCACGAGCACAACGGC
ATATACGGCATCAGTCGGCCACCCACAGGTAATCCGGGCTAGCGAGCTCGCCAGGAGGCCACAGGAGAAGGCAGCAAAGT
CCAGCGGTATTCAGACGAGGGGATCCGCCGAAAAGAGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62