GenePrediction:GLEAN_573 Details

Name: GLEAN_573
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:692141..693171 (+ strand)
Length: 1031
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:692141..692279 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_97:692304..692341 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_97:692410..692459 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_97:692530..692841 (+ strand)
Length: 312
Type: CDS
Source: GLEAN
Position: GCSC_97:693138..693171 (+ strand)
Length: 34
>GLEAN_573 class=GenePrediction position=GCSC_97:692141..693171 (+ strand)
ATGAAGGAAGACAGCGGCGCAGTAAAGCCTACGAACTTCCACAGGATCGTTGTGCGGTTTCCTCGGTACGACATCAAGAT
CGTTGTGGACGAGCCCGGCAACGCCATGCGCGCCAAATTCCCCACGGCGCCAAAAATCTGTCTTTTCTGAGCGTCTTTGT
CAGGGAGGATGCGTATTCCGGCGTACCGCCTCGTGGTACAGGTATGCAGCCTGTTTCCCGACAAGATTTTACTTTATGAT
TTGTCGCTCTGCTAACTATTGTGGCACAGCTCCGCATGTGTCGCGGCATGTTTGGTCATATCACAGACGTCCCCAACCGG
TATGCTCCGCCATTTTTTTGTCCACTGCGCTGGGTCGCAGGTTTTCACCAACCCAATCACGGGCTCGAGGCGCTGCCCCA
ACCAGACCAAGATCGCTCTTGACTTCATTCGCGATTTTATCGAAGCGAATAAGGTCGACGCCCGCAGCGTGCGTGTACTT
ACGCCGTACGCGGCGAATGTGTACCTGATCAACAGCATGGTCAGGCTGCCCGAGTACTCTTCGCTGTCTTCAATGGAGCC
GGCCACGACCGTCGACTCATTTCAGGGCCTGGAGGCCGACATTGCGGTCGTCGTGCGGGCGTCAGGGTCAACTCCGGCTC
CCGCCGGAGTTGACCCTGACGCCCGGCTCCTGCCGTTGACGTCCCTTGACGCTGGGACTCCGTCCCAAGCGTGGACGCGT
GTTGCCACGGCCCTCGAAGCCATGGCAAGTTGTCAAGCATTGGAATCCGCCACACTGTAGACCTTCCGCCCCATTTGGCC
GTACGGGCCTGTGATTGGTCAGAAGGCACAAAAGCGGGACCTGACACTAGTATTGATACGGACCCCCAGAAGGGTCGCGA
TGTATCTATTTCTTCCTTAGCACACACTAGACCCTATTCAGCCTCCTGCTCCTCACAGTGCATCACGTTATATGACCGCC
ACGTACTCCGTATAGCCTCCTTTAACCTTCACACAAGTCCCTCCTCTCCTGTTGCCGAGTCCACCGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62