GenePrediction:GLEAN_5740 Details

Name: GLEAN_5740
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1281723..1279187 (- strand)
Length: 2537
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1281723..1281233 (- strand)
Length: 491
Type: CDS
Source: GLEAN
Position: GCSC_173:1281162..1281102 (- strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_173:1281031..1280507 (- strand)
Length: 525
Type: CDS
Source: GLEAN
Position: GCSC_173:1280452..1280061 (- strand)
Length: 392
Type: CDS
Source: GLEAN
Position: GCSC_173:1279994..1279292 (- strand)
Length: 703
Type: CDS
Source: GLEAN
Position: GCSC_173:1279219..1279187 (- strand)
Length: 33
>GLEAN_5740 class=GenePrediction position=GCSC_173:1281723..1279187 (- strand)
ATGGCGGACAAGGAGGCCACCGTCTACATTGTCGATCTCGGCATCACTATGAGCGAGTGTTGTGGCGGCCGCACGGAATC
CAACCTGGACTGGGCCATGCGCTATGTCTGGGACAAAATCAGCACTACGGTAGCTGCTTCGCGCAAGACATGGACTGTCG
GCGTATTGGGCCTGCGCACCGACGAGACGCGCAATCCGCTGCAGGGAGAGGATGGTTATGAGAACATCGCCGTCCTGCAA
GAAGTCGAACCCATGAGCCTGACGTCGCTGCGAGCTCTGGGCAGTCGCATTCAACCCAGTTCTACCAAAACCGGTGATGC
AGTTTCTGCCATTATCGTGGCCACAGACATGATCAGCAAGGCGGCGCCCAAGCGACTCAAGTTCAATCGCAAGATAGTCT
TAGTGACCGACGGACTAGGTCCGATTGACGGCGACGACTTTGACGATTTGGCCTTTCAGCTAAATGAATTGGACATACAG
CTAATCGTTGTGTACGTTCACTACCCAATGACTATTGTATATTTTTCAGAGATTGTGAACAAAGCTGACAGGTCGCTTCA
GGGGCGTTGATTTTGACGACGCTGAATTTGGATTCAAGGAAGAGAATAAGCCTCCGCTAAAGGTAAGTGCTATGCAGCGT
GGCAAGGATCATACACCTGCTCGTATTACTTCGTTCGATCTAACATAAATAGATATACAATGAAAACCTTCTTCAGAGCT
TGGTTGAAAAGTGTAGCAGGAGCGTGTTTGGCACCATGGCCGAGGCTATCAAAGAGATGGACAGACCGAATGTAAAGCCT
TATCGGCCGTACAAAACCTACGATGGGCCCCTGACCCTTGGAAACCCAGAGAGCTACGAGAGTGCTCTATCGATTGAAGT
AGAACGGTTCTTCTTAACCAAGGTGGCTCGTCCTCCTCCTGCAACTACCGTAGTGGTTAATACGGAAGCCGATGGAGCCA
CTCAATCAACACCGATAGATCCAATGGGCGGCATAGAGATTGGCGGCTCCGACTTCTCCAAGGTTCAAAACACACGCGTG
TATTCAGTCATCGACCCCAGAGCCCCGGGTGGCAAGCTGGAAGTCGATTTTGACGAGCTCGAAAAGGGCTATGAATACGG
CAGGACGGCGGTGCATATCAGCGAGACTGACCGCAACATCACTCAGCTGAAAACACTGAAAGGGCTTTCTATCGTTGGCT
TCATCAGCCAGGACAATGTGCGAGCATCTTTCTTCGTTACTTTCTTTCGTGGTGCTCTAACATTCGCTTAGTACGAACCG
TTTCTCAATATGGGAGAGAGCTGCATCATATTACCCCGGAAGTTCAGTGAGCAGGACGAAGTCGCATTCTCTGCGCTTAT
CCATGCAATGATCGAAACGAAGACATACGCCGTCGCCCGGTTTGTTGCCAAGGATATGAAGGAGCCGCAGCTGCTGCTCC
TCTTCCCAACGGTTGCAGAAAACATAGTATGCTTCTACGACGTGCCGCTTCCTTTCGCTGAGGATGTTCGCACATATCCA
TTCCCGCCGCTGGACAAGGTTATAACGGCCACTGGCTCTGTATTGTCAAAACATCGACTTCTCCCCGACGACAAACTCAA
CCAAGCCATGAGTGATTATGTCGATGCTATGGATATCTCAATGTTTGGAACAGACGACGAAGGGTAATCAGGGCCAATGA
TCCGACGTGCTTTATATACACCTTTGAGATCTTTTCTGACACTGCCTAGGCAACCTGCTGAATACGTTGACCTTGCCGAT
AACTATTCGCCTATTATATATCGCGTCAATAAGGCACTCGCCTTCCGAGCCGTCCATCCCGACGAGCCCTTTGTCCAAGT
GGACAACGAATTTGTGACGCGGTTCGATCATCCACCGCAAGAGCTCGTGCGTCAGGCGAAGTCGCAGATAGAGTCCCTGA
TCAAAGTAGCCGATGTGAAGAAAGTGCCACCCAAGGCGAAGGGCAGAGCCTCCCGCAATGCAGCGGCAAACAAGCCCTTG
TCGGGTCTAGACGTCGACGCTCTCCTGGGAACACCTGCCGCCGCCAAAAGCGGGAAAGCCACCAAGATTTCAAAGGAAAA
TGCCATCCCTGAATTCAAGCAGGCGCTTGCTGGCACGGTTGACGTCAAGCAGATTAGTGATCTTACCGCGCAAATGGGTG
AAGTTGTGCGATCGCTCATTACCAGCAGCACGGGCGACATCCATTACGCACGAGTGGCCGAAAACATGCGAGTTATGCGT
GAAGAGCTCATCAGCCTGGAGGAGCCTGCCTTGTACAATCAGTTCACAACCGATCTCAAAGCTCAACTGGTAGCCGAAGA
GCTGGGCGGTCCGCGATTGGAGATGTGGTGGACAATTCGGACGTCTGGCCTAGGCCTGATCACAAAAAGCGAATCTGACG
AATCCGATGTCACTGATGAGGCAGCACGGGAGGTAAGATACAGGTGACGTCGCTTGCTTGTTGATGAGTTGGCTATTTGT
GAAACTGACGCTCTGTTCCAATAGTTCGTGCGGCAGTTCAAGCCAAAGGAGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62