GenePrediction:GLEAN_5741 Details

Name: GLEAN_5741
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1278090..1276141 (- strand)
Length: 1950
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1278090..1277367 (- strand)
Length: 724
Type: CDS
Source: GLEAN
Position: GCSC_173:1276817..1276663 (- strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_173:1276434..1276141 (- strand)
Length: 294
>GLEAN_5741 class=GenePrediction position=GCSC_173:1278090..1276141 (- strand)
ATGTCAGAGCGGACCCTATACGAACGTGTGGGGGCCCTCAATCTTTTGGACAACAGCGACACACAGGTTCCTGAGACCCC
GGTAGTACTGCCTCTTTCTAATAAGCACAGCTGGCAAGCTCAGCCGAGGAACGATCTCAAATGTGGCGAGTCTTATAGAG
GCAGAAAGATCTCGTTCTGTCCGTGGAACATTGTCACTCATTACCACGAATGGTTCGTTGGCAAAAAGAACGGCGAGCTC
ATCCGCCCGTATTTCGATGCAACCGCGCTCCTCCGGTGTAAGCTCTGGGACTTCTATTATGTTTGGCACCCAGCAAATGC
CAAAAAGGACTGCTATGCCATTGTTGTCCCTACAGATCAGCTTGAGGATCTTATTTCCCGCATCAGCGAAACACTGGACA
TCCAGCTTTCCATCCCAGCTGGTGTGCATTCAGTGAAATTCCGGGTTATATTTGGCGACTTTGGCACGCCGCTGCCAAGG
TTTCTAGGCCATGCATTGGACCCTGCCGCTTTCTCCAACATGGTCAGCAATATGCCCCCCAGCAATCCACGGGATTCTGT
CTATGACATGTCACGCATTTCCCCGCAAGCTCAAACATCATATCTCAGGAAGGTCGATGGCCTGTTTGAAAACCACGACA
AGGCCCAGCGAAAAAAGAACAAATCGGCAAAGAGTCTCCAGAGGACCCTTTACCAGCGGAGGAGCTGGGGGAGACAGACA
AAACGTGTGCAGCGATATCTTGGGCTGCGTGATAAACGCGGCAAAGGCAAGCACCCTCGGACTTTCAAAACCTATCGAAT
GATACCCTAGGGAAACAACGGATGACTGACTACCTACTCCAGATGGTTCTGACGTGTTAAAAGCATTGAACCATGGAAAA
CCTACAACCTGTCTTGCCGAAGGAGGCGTGATATTTGTGGCAATGGACATTGAATCATATGAATTCAACAGTCGGATGGT
GACAGAAATCGGGTTCGGAATCTTGGACGCGAACGATGTAGTAAGTGTGGCCCCCGGAGAACAGGGAAAAAAATGGCTTT
CTCTTGTCCGTGGGCGGCACCTCCGCATCCGAGAACACGCACATGCCGTCAACCGAGTTCATGTGCAAGGCTACGAGAAC
AATTTCAATTTTGGGTGAGTCACGCTATGGACTAGGCTTCAGAAACGCATTAACTGACATCGGTGCATTCTGCATGCAGC
GCGTCTGAGTTTGTCAAGCTGAACGATGTCCCCCAGTTGCTCGGAGAAATACTTCAACCGAGCACTCCTACAGGCGAGCC
CAGACAGGTCGTACTGGTTGGCCATGGTATAAGCAGCGACCTCGAATTTGTGAAACATGTTGGCTTCGATATAGCCAGGG
ATGCCAAGTTTCTGGAGATTGTCGACACGCAGGACATGCATCGGCATCTCCGCATGTTGCCCCAGCAGGTAAGTCTGGCA
AGGGTCTTAAGCGATCTCGATATAGAGAGCAGCTTTCTACATAACGGAGGTAATGATGCGGTCTACACACTGCAAGCCAT
GATCGCCCTCGCAGTAATGCAGCGGGATGCCAGCCTCCGAAGACATCACGAGCGACTACAGCCAAGGTAATAATTGCCAG
CTCTGTCCAAGCCCGTGCCAGTAGCATGTTTCGACTGACAGCCTTTCAGTTTTCAGCCTGATCCTTCAGTTGGGGAGGGA
GGTTGGGACACCAACGGGGAAATGAGCGACGGAGGGTATCCGGAAAATGAGCCAGAATGGAAGGACGAAGCTCCTGCTCC
TGCTCCCGTGTACGAAGCTGTGTACGAAGCCAAAGTCAAGCAACCCAAGCCAATTGTCAAAATCTCAGACGAGGAAGCAG
AAGCACGCTGGGGCGCCCAAGAGCCGGTCGACTGGCCCTCGAATTCGCCACAGCAAGCAGGCTCATCATTTGAAGGAGTA
GAGGGCGAAGAGGACCTGATTTGGCTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62