GenePrediction:GLEAN_5742 Details

Name: GLEAN_5742
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1275008..1274073 (- strand)
Length: 936
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1275008..1275004 (- strand)
Length: 5
Type: CDS
Source: GLEAN
Position: GCSC_173:1274928..1274902 (- strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_173:1274830..1274746 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_173:1274618..1274073 (- strand)
Length: 546
>GLEAN_5742 class=GenePrediction position=GCSC_173:1275008..1274073 (- strand)
ATGAGGTAAGAGATATTGGCATCTTCTGTTGAGAATAATAGGAAGGAAGGGTGCATGCTAACAGTGTTTCTGTGCAACAG
AGTCGAGACTTGTTATTTCTGCTCCCGGTAAGGATATGCTGGAGATGAAGTTGGACAGCAGCTCGAGATGGCGAGGGAGA
AGGCTAATACGAATACAGGCCCACGTACCCGGGCAAGGGCATAATGTTTGTGCGAAACGACAGCAAGACCTTTCGATTCT
GCCGGAGCAAATGTCACAAGAACGTAAGTTGCTAGACGGTGGACGAGATGAGTTGGAGAGGGAGAGCGAGCAGAAAGAGG
AGAAAAGAGCAAGGCGCTAGGTGGACGAACACGGGATGACTGCTGATATCGATTGATCCACGCTTTCTAGTTCAAGATGA
AGCGCAACCCCCGCAAACTCAAGTGGACCAAGGCCTTCCGCAAGGCGGCCGGCAAGGAGATGTTGGTCGACTCGACGCTG
CTCTTTGCGGCACGCCGCAATGTGCCGGTGCGGTACAACCGGGAGCTTGCGACCAAGACGCTTTCTGCCATGGACCGCAT
CGCGGAGATCCGGCGTCGCCGCGAGCGCGCATTCTACAAGCAGCGCATGTCGGGCAACCGCAAGCGCGAGCTGCTGGCGG
CACGGAAGCTGGTTCTGGAGCATGGCCACCTGCTCAAGGAACTGCCGAAACGGCCGATCCACAACAAGGTGTCGCACAAG
GAAAGCGAGAAGCAGTCGGAGCTGCTGGAGGAGGACGAACTGGAGGAGAGCTTGACCGCCGGCAAAATCAAGGCACGCAA
GGTGGTGCGGCAACGCATCACGGCCGACGGCGACTTGGAGCTCGAGGAAGAGACCGTGGCCGACGTCTCTGGCCTGCTGG
ACGACGAGGACGAGGACGAGGACGAGGGCGAGGACGACGACATGGACATGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62