GenePrediction:GLEAN_5743 Details

Name: GLEAN_5743
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1269601..1267537 (- strand)
Length: 2065
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1269601..1269587 (- strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_173:1269361..1268679 (- strand)
Length: 683
Type: CDS
Source: GLEAN
Position: GCSC_173:1268598..1268475 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_173:1268370..1267537 (- strand)
Length: 834
>GLEAN_5743 class=GenePrediction position=GCSC_173:1269601..1267537 (- strand)
ATGGCATCGTCAAAGGTGAGTTGACTCATGCCTATTATATGCACGACATCCGCACCCCCTTGAACACCGAATGCGGGAAA
TCTGTGGGATCAAAGTCAAGGAAACCACAAGCGAGAGAGAGGGGGTTATCTAAGAGAGCGACCCTTGGGAGAGTCGAGCA
AAGACGCTGAAGAACAACGGCACGGTCGCAAAAGAGATAGGGCTTCCATGCTGACAGTTTACACAATCGCCTCCTGCCAG
GAAATGCAATCGACAGTCAGACCATTGACCCACCGTCCATCCATTCCCAGCGCGCCGAACGCGATCGGAGCCTTGAGTCC
AGGCAGTTCCAATAGCCTCGCAACCCGACAGCCGCACTCACGAACAGGATCCCATTCGATTATTGGAGCTGCCCTAAACG
CGAACCACCGAGTCAGTCGTCGGAAGAGCATGACGAGCCCCGGGGCCACAAACGTTGCTGCCATGGCAGCGCTGATACAA
GAAGCGGATGCTTTGCCCGTTCCAAGTGCTGGAGCCGGTGGCCGTCGCAACACCGCGTCGAAAACCAGCGCCGGCACTAT
CAGCGGGTCGCCCGGCTTCTTTTCCCGCGCGCCATCGGCCATGGCGGCCGCTATGGCCATCGCAAACGGAACGATTGGCG
GCCTGCCCCTGCCGTCTCCACCCGCGAGCCTACCCAGCCGGAAGTTTGTCACAGCCGATGGCAGTGCCATTGACGACGAC
TTCAACGATATGTCGGACGTGGAGGACGATTCGACCATGCGAAGCGACCTAGGAGCGAACATCTTCGACATGGCGCACAT
TCGCCGTGCCAGCGACGGTCAGCCGCTTGTCAAGGAGGGCCGGAGGAGCAGCACCCGTATGGACCTGCGCTGCGATAAGT
GCGGGAAAGGATACAAGCATAGCAGCTGCTTGACAAAGCATTTGTGTGTGCCCACTCTCCTTACCCCGCCCTTTACCCGT
CCTACCCATCGTGCGACTGCTTTGTATGCATGCCGATGCCAAGCGGCGCTGCCCGGGCCTCGATCTCGCAGACGGTCGGC
GCTGCGCTGTGCACATTTCGGACGGTCATCGGCGGCGTCGGCACTCCCACCATCCGATCCTCTTGTCACCACCTCCTTAT
TCAGAATGTTTGTTTGTTGACTTCGTGTTTCTTCTTTTGTCGTTTCGCAGGTGGGAACATACTCCCGAATGGTCCTATAC
ATCGAAGCTCCTCATATCGAAGCATCAACAGGTGCAGCTGCTCGAAGCCGCCTCCGTGCTGGTAGCAATGAACAACCAAC
ACCCCAACGCCGACGTTACTGTGGTGAACACCCCGCCGGAGTCGGCTCGAGACTATACCAGTGAGCGTGACTCTGCATCA
CCGATTGCTTCGACGTATTTCGAACAGAACGACGGACACAGCTCTGTCGACACGACACCCCCTCCGCAACTGGAGGGTGC
CATGAACATCGACGGGCCCAAGAGGGACCCGTCACTACCTCATTCGTCGCCACCGGCATCGCTGCTGGCAGAACGCCGCC
ACTTTTTGCAGCGATTTGGGCCAGGCAACGGCCATGGCGGCATTTCCCAGTCGTACCAATCCGGCCTCCCCGCTGGCCCT
GTGGCTGGTAGAACGCTTTCTACTGGATCCGTCACGAGCGACGCATTCGCATTCGGACACCAGCCACACCGAGGCAGCCT
TCGGCCATCGTCATCGGGTCGGAATACGACCGGCCAAGAAGACAATGAACTGGCAGCAGCGGTAGAGATGCTGAGCTGCA
GCTTCAACAGCGCCGGCGGGGAAGTTCACGGCTTCGTGCAAAATATGCCCCCCGTGCCGCCCGTCCCGGCCATGTATCTA
GGGCAGACTGCGCAACCCCTTGACGATACGAGCTTCATCAGCAGCTTTCCAAGCCGTGCTCCGGAAAGTTTCACGCGCGG
CGATCGTTTCAGTGTTAGTGGCTGCGACGACGTCATGATGGAAGAGAGCAGCGAAAGCTTGACGGATGAAGACGACGATG
ATATTCGCTCTCGTGCTCGAAGTGACGACGACGACGATGGCGTGTTTGGACGCATGGAAGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62