GenePrediction:GLEAN_5744 Details

Name: GLEAN_5744
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1266456..1264946 (- strand)
Length: 1511
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1266456..1265864 (- strand)
Length: 593
Type: CDS
Source: GLEAN
Position: GCSC_173:1265776..1265704 (- strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_173:1265626..1264946 (- strand)
Length: 681
>GLEAN_5744 class=GenePrediction position=GCSC_173:1266456..1264946 (- strand)
ATGGCACGAATCAAAAATTCGGCCAAGTCGGCGTCGAAATCTGCGGCAAACAACGATGCGGCGCTCACGGCATCATCAAC
GCCGGCAACCCGCAGAACGGCACCAACTATAACGGTTAGAAGCGAGCCTAGGAAAACTAGGAAAACTAGGACTAAGGAAG
AAACGGGTCAAACCAGTGGGAAAGGTCGACAGGACGTCAAAACCGACAGAACCTACAAAGTCGTCAAGCATAAACAGAAA
CCCAAAGAAAGCGATGACGAACAAGACGAACAGGACGAGGAGCAGGATGTAGGCGGGCAAGATAAGGAAACAGAGGAAGG
ACTAGAACATGCCAAGCACGAGTCTTCAGATAGAGACTTACACTCTTTGCTCCCTGGAGCTCTGTCGCCTTCTGTGGACA
CATCTCGTGCTTTGGGCGTCATTGCTGTCTGTGCCATCGTATCCTCAGCTCTCTCTCTCGCCAGCCATATGTTGGTTAAC
TGGATCACATCAACGTCGACACTGCCACCCCCATGGGCTGCCTGGACCTCGTATTTGGGCGCCATGGCCTTGCCGTCCGC
CTTGACGCCAATATCGAGTCTTGCCATTCGCATGTGAGAATCTCCTCCTTCTCGCCCTCTGTCCACAGTATATTTTCTAG
TAAAGTACCACAGTGAACAAGTGCTGACGGCTCTTTACAGGTGCAAAATCTCTCTTGCATGGGGCAGAATTACAAATGTC
GTTGCCTTAGACGTGCTTGCCTATGGGCCAATGGTACGTGTGAAAGAGGCAGCACGTCAGACCTTGTGTGCACCAGCTGA
CAGTCATGTTTCATCGACTGCTCCTTTCAGGTCTACTTATTCGCGGTACTCCATTGCATTCCCCTGCCTGCTGCCTTAGT
GGTGGCTGCGATCGACCTGATCGCAGATGTCTTACCTCTTCTCGCCTGGAAGCGGCTAGCTGACAGCACCACTTCGGATG
ATGATGATGATGACGGTGTCGACGAGGCCGGAACGATCAAAGCCGATCTCACCAGCGACTCTGGGGGTTTCGGAGACCCG
GTAACCTATGCTTGCTCCGCCGCCTTCGCGAGTGCCCTCTACAGCTTCACGTTCGTGCAAGCTTGTCGCCTGTACTTGCC
CAGGATCTTTGTCGTCCATTTTTGGAACATCGCCACCGTCAAGCCGGTGAGGACACTTCCGATATCAGCGACATTTCCGC
CATCCGTGTCTGAGTTCGGCAAGGCTGTCTTTCTTGGCTGGCCTTCTGTTGTCCTCAGTCTTGTATGCGGCGTTGCCGCC
TACAGTTTTATTTTTACTGGGACGAGCAGTCCGCCATCCGCCTCGCCATCCTACAAGAAATTTGTGGCGGTTCGTACTGC
AGCGCTTTCTCTCGTTGTCAGCACAAACATCTTTCTGCAATGCTTCATGGGTGTCCGAGGCATCGATGTCGTTGGAGCTT
TAACTTATGCCGCAGTCTGGGCAGCAGCTCCGCTGTTAGTGGGAGCTGCATTGGCGCTTGCTAGATCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62