GenePrediction:GLEAN_5745 Details

Name: GLEAN_5745
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1263136..1262245 (- strand)
Length: 892
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1263136..1262766 (- strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_173:1262689..1262636 (- strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_173:1262582..1262484 (- strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_173:1262410..1262245 (- strand)
Length: 166
>GLEAN_5745 class=GenePrediction position=GCSC_173:1263136..1262245 (- strand)
ATGCCAAGAGGAAGGTCCCATCGTCATGCCGGAACTGCAGCCACTTACACTGAGGGGGGGTCTGACAATCCATGTTTCTC
GTACCAGCCTCCATCTGCTTCCAACGCCGAGTACGAGGATATGGTGCTCACCTTTGAGGAAGGCGAGATAGACTATAATT
ACCAGGACAGCTCTGAAAGCAGCGGCAAGCCTGGTGCTACAAAGAGGAAGAAAAGTGTCAAGTCGAACTCTTGCCTCGAT
TTGACAGGGCCAATGGAGGTGGACGGTTCTGTCAAGGCTATGGGCTCTGTCAGCTTTGTCGGAGAATTCTCTGTTCGGGA
CAGAGTTGAAGCATACGGGAACATTGCTGTCAGCGGAAATCTGACATGCAGGTATGTAGTTGGACTTCCAAGAAACCCTC
TTTTGAGACCATGTGTATGCTAATGTAATATGTTGGCCCGGATTTAGCGGCAAGATCAAGTCGTTTGGAAATGTCGACGT
AACTGGCTACGTTTACTGCGGGTATGGCTGTTTCACCCCTGTATGTTGAAAGGTATGACTGACATGGGGAACAGAAACAA
AGTCCAGATATATGGGAAGCTCACCATAAACGGTCACTTTGAGGTCCAGGAGAGCATCGAAGTCTGGGGTGCCGTCACTA
TCCAGGGCTTCCTGTACGTATCCCATTAGTTTTTTTTTGTGAAATTTTCATCATATACATGGGCTAACATATACATTGCA
ACATAGGAAGTGCAATGCGCTCACTGCATATGCATCTGTTACTACTATCGGCGACGAGTCCTGCTATGAAGTTGTTGAGC
CCGAGACCGTCTGGGGCGCCAAGATGGTAAGGCGGACATCAGCCGAGGCAGAAGGGATGCAGATCGAAGATACGTGGGGA
GCCTACTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62