GenePrediction:GLEAN_5746 Details

Name: GLEAN_5746
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1261441..1258250 (- strand)
Length: 3192
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1261441..1259485 (- strand)
Length: 1957
Type: CDS
Source: GLEAN
Position: GCSC_173:1259420..1259184 (- strand)
Length: 237
Type: CDS
Source: GLEAN
Position: GCSC_173:1259023..1258452 (- strand)
Length: 572
Type: CDS
Source: GLEAN
Position: GCSC_173:1258384..1258250 (- strand)
Length: 135
>GLEAN_5746 class=GenePrediction position=GCSC_173:1261441..1258250 (- strand)
ATGGCTGCTACGGAGTCCGTGCCCGTGATGGGCGACACCGAGACGGGCACCACGGCCGAGCCTCAGCGCAGCGAGGAGGC
GGGCTCACCACGACAGAAAACGATGCGATCCTCCCTCCGTTCGATACATGCGTCCTCGCCAATGCAAACGATGAACGGTT
TGGCAGTCGGGGCAGACGAGGCGGAACCCAGGGCGGCAGCGGCAGCGACAGTACTAGAGCCACACTACTCGTCGATAGAC
AGCGGACTGGAGTCACTGAACTTGCGTCCAGACCCAGACGCCCAAGCAACGGTGACGGACTTCCTCGACTTTACCGAATA
CCTGCCCTCAGACATTGTGCGGTCGCTCACGCTGATCGGCGATCTCGACCAGACGTACGTGGACGCATCGACAAAGGTGC
ACGAGCTCACAGCGCTCTGGGGGAGCTTGCCGACGATGGCAGCGGAAGAGCGACGGCAGCCGGTGAAGCTACGGGCCGAT
ATATCAGCGAGCCTGCGCCGTGGTCTTAGCTCGCGGATCTACGCACACGACGAGGCCCAGCGGATGGCCAAGAATGTCAA
CCGCCACTACTACCGGGCCAAGACGATCCTGGAAAAGCTGCGGGCCATGCTGGAGAACTACGCAGAGGCAGAGGCGGAGC
AACAGGAGCAACAAGAACAACATAAGCAACGAGAGCAACAACAGAAGCAGCAGCAGCAACAGCAGCAAGCAGTGAAAGGG
GCAGCAGCGGCGGCTGCAGGGCGCGGACCAAAACAAGTGGGCGTGGCACGGGTGCATCGACAGAGAGTGCCACGCATTAC
AGTACCGGGCGAGGTGTTGGCGCCTTACGACATGGAATACGACGTGTTCAGCGACGACAGCGACGTCAGCTCTCCGTCGT
CCTCGGACGAGTCTCTGGCCCTGGGTCACACGGCCGGATCGGCGGTGCAGCCGCGCATCAAAGTGTACAAGGCACCAGGC
GGGGGTCTTTCGGCGGCTGGGGGGTTGTTGACTGGTTCGGGGGCACCCAAGCCGCCAAAGGTGCGGATGCCGCGGGCTCC
ACGGCAGCCGGGGCAGCCGTATTTGTCGACGAGCTCGGCGCTGGCGCAGCTGAAGCCACCACCGGAGAACGCGGTGATTG
GCAGCGCGGACGCGCCGTGGTTGCAGCTGACGCCATATGAGCTGGCCAAGCTGCGGAAGAGAATGAAGAAGAATGCGCAG
TGGACGCCGAGCGAGACGATGATTGCACGAGAGCTCAAGGCGCTGGGCCGGAATCTAGAGGCGTACAAGGTAGCCAAGAG
GAAGGCAGAGGAGGACGGACGGCCATTTGACGGGTCGCTGCCGGAGGCGGTGATGGAGGCAGACGGCGTGGCTCGGGCGC
CTCTGGGAGCGTTGAGCGTGGACGCGGCCCTGGCAGCAGAGCACAAGCAGCTGACGAATCGAGGGATGAAGCTGAATGAA
GCAAAGAAGCTTAAGAACAACTTGGCGCAGCTGGCGGCCCAGGAAGCCGAGGAGTCTACGCGCAAGATGATTGAACAAGC
ACGGGCTCTGCTGTCGCCATATACGCAGCAGAATGCAGGGAGTGGTGGTGCCGGTAGCAGCGGCAATGGCACCGGCAGCG
GAAGCGGTGGGAATGGTTCGACTGCGACGACGCCGGCGACATTGGTACCGGGGACGGCGGACCAGGGAAGCAGCCGACAG
GGCAGTATCGCGGCGACGCGAGCAACGACACCGCTGTCACGGAAGCGGAAGCGAGAGGCCGGGACGGCCGCCGGGATGGC
CGAGGGGACGGACGGAAGCGTGGAAAAGGTGGAGGGATCAATGGAGACGATATCGTCCATGTCGTCTCCAGCATTGACGG
CCGTCGGTGGAGGATCAGGGTCGCAGTCGCAGTCACAGTCGCAGTCGCAGTCGCAGCGGCAGCTGTCGAAGCGAGTCAAG
ACGGAGACGCCAGTCCCGATTCCACAGCACGCGGCGAGTTTGGTCAGTGCGGTGCCTCCGTATCCGTCCGAGACGCCGGT
GCATCCGCCAAGATGCGGCAGTACTCGACGACGCCGGTGCCGACGCCGGTGATGGGTCCGGAGCAGCCGACAGCGACAGC
GGCAGCGATGTCGTCGTCTCTGAAGCAGACATCGTCTTCGACATCGCCGCTTTCGGTGGTGTCGAGCCTCTCGGTGGCGA
CGGTGACGACAACGGTGCCGCTGAAGCCGCCAGCCGAGACGCCAATCCCGCCGCCAGTGCACTCGCCTCGGAAGTCAACG
ACGCCGATCCACCCGCCGGTGAGAGAGTTGCGAGCACGAGAGATGACGCGGAGGGGGGAGAGGGGGGAGAGGGAGAAGGG
GGAGAAGGGAGAGACGGGAGAGAAGGGAGAAAAGGGAGAGAAAGGAGAGAAAGGAGAGAAAGGGGAGAACAGCGGAGAAG
AAGGGACAAGTCTACCAGGCCGGACGACATCCAAGCCACCGTCTCGAGCGGTGACGCCGGTTGTGCCGATCGTGATCTCA
GCGGATACGAGCAGCAACATAGGAGCAGAAACGACGGCCATATCAGCGTCGATCACGGCCACGACGACAGCTACAACTAC
AATGACGACAAACATGACACGACGGCCGCAGTCTCGGGGCGCCAGCGTTGGCGGCAACAGCGGCGGCGGACTGGGCCAGG
AGCTGGAGGCGACGCTGGCATCAGAGCGGCCGCGACGAACGAGTGCAGCACGCCTCACGCCCGGACCTGAAGCTGGGCGG
ACAGCGAACAAGCGGGTTAAGCGCCCGGCTCCAGGAGTGATCAGCCGGACGAACTCGGGCGGCAGCGCAGCAGTGGGACG
ACGCAAGGCGGCGCCACGAAAGAAACGAGGACCACAGGCGGCGGTATTGTTACAGCAGCAACAACAGGCAGAGACAGACG
GCGACGTGGAGGTAGACGACGAGGGCAACGTGATTGACGCGGACGAGCCGCGATACTGCGTGTGCAACCGGGTCAGCTTT
GGGACGATGATCCAGTGCGACAATGTTGAGGTGAGTGGGGATAAAGATGGATGACCGAGAGAGGATCCAAAGCTGACAAG
AACAGAATTGCAGACAGGAATGGTTTCACCTCGAATGTGTGGGACTGACAGCTGTGCCGGCGCGCACGACCAAGTGGTAC
TGTCCAGACTGCCGGGTGCTGCTGAAGATTGGCGAGAAGGGCGAGGTCAGCGCCCGGGGCGTGAGGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62