GenePrediction:GLEAN_5747 Details

Name: GLEAN_5747
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1257056..1253242 (- strand)
Length: 3815
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1257056..1257050 (- strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_173:1256983..1256902 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_173:1256830..1253242 (- strand)
Length: 3589
>GLEAN_5747 class=GenePrediction position=GCSC_173:1257056..1253242 (- strand)
ATGCCCGGTAGGTTGATTCCTCCCTCTGATACGGCTCTGCTGCCCTGTCGTGCTGACCCGCTCTGTCGTGCAGGTCCGAA
GAAGGCCAAGAAGGATGCAAGAGAGACTGGCGGCGTGGTCGCTGCGGTGACCAAACACGCCACCGGTAAATTCACGTATG
TGCCACTCTTGCTTTCATCGCATTGCCTGTTGCTGACCCGTGTCCCGTGTTTCGCTCGGGCTACAGAAACGGAAACGGCC
AAGGCTTCGCCTCGGACACGTCCAACTCTTCCGGCCCTTCGCCCGACCTGCAGGCTGTCGCCTCTTCTTCGTCCAATGGC
AGCTCCTCGGTCTCGCCCATGCTGGAGGCCGTGTCGTCACCGGCCGTCGTGCCGACCTTCAACCCGGCGCCCAGAGCCAT
TCCCGCCAGGGTCGACTGGCAGACGCGTGCCAACGGCGGTTCCATTCAGCCTAGCATCGCTGGCTCGCCCGGAAACCTGA
TCAGTTTGATGGGAGACTCGCCACCGAGCCGCTGGTCCTCCCCTCGGCCCTACGGCACGAGTCACACGAGTCACACGAGC
CAGACGAGCCACATGAGCCATATGAGCCATTTGAGCCATGCCAGCTATGTCAGCCAGGCTACCCATCCGACCAGCGTCTC
GGTGTCGCCGCCAAGCGGCGGGATGGACATTGCGGGCAGGCCTGGCCGACGTCCCCTCAGCTACCACATGGATACCCGTC
GCAGCTCGCTGCACTCGCATCTCGCCCAGTCCCGGGCTACGGCCACGTTGGCTGCAGCGTCGGCCGGGCTCTCATCCAAC
CCGCCCCTTCCTCACCAGCCACAGGCTCATTTCTACGGCGTCCCCGACATCGATCTGGACCTGCAGCCGCACCAGGCCGG
CATCAAGCCTGGCCAGCGCGGTTACCATTTCTCGTTTGACAGCCTGCCGTCAGCGTACCCTGGACGGCAGGCCTCCCTCG
GCACCGGCACCGTCGTCACAGCCGGCTTCGAGGGCGGGCTCAGAGTCAGCCTGGTATCCAAGCGAGGTCTGGAGCCGCTG
GCCACACTTTCCGGCCTGCGCGGTGGTGTCTACGGCGCCAAGATTCTGCCTTGGATGGCTCCGGGCACGGCAGCCGAAGA
CCTGTTCCCGCTTGTTGCCGTCGTGGTGCATGGACCGGTGCTGCCGGAGGCTCTGTACCCCGAAGGCGAAGGCGACGGCG
ACAGCGGCGTCGGGGTCGGGCTGACGGATGGGGGGGCCGGAGCTGTTGCTGCTTCTGCTTCTGCTGCTGACGGCATCGAG
ACAGACGCGCGGGTCGACTCTGAGAAGCGACGGTGTATCGAGTACTACCAGACGTCGGTCGAGGTGTATTCGCTGAGGCA
CAGCCAGTGGATCTGCACGTTGCTCGAGGCACCCAAGATACCGCTGGCGATCCCGGTGACGAGTCCCGTGTTTCAGCCGC
CGCCGCCGACGGGAGCCTTTCAGATCAAGGCCGACGGCGGGACAGTTGCGGTGTCGTCGGCGACGACGGGCGAGTGCTGG
GTGTTCCGGCAGATGGCGGCAGGTAGCGAGGACGTGCTGCCGTTCTGCTGCGTGGCTAAGCTGTGGACAACGCTGCAGCA
GTCGCCCAGAGGCTCCAAGGGTAGCAGCGAGGCTACTCCTGAGACCGAGCGCGTCCGAGCCGCATCCTCGGCTGCGTCTA
GCCAGACGCCATCGCGACACAGTCCCAAGCAGGCAGTGCTGTCGCTAAGTGGCCGCTGGCTGGCCTACTGTCCGGCCAAC
CCGTCGTCACAGATTGCGTTGCGGGCGGTGGTGCCGGTGGCTCTACACGGACGAGCACCCGGGATCACGTCTCTCACTCC
GCCGCAGCTGCCTCCGACGACGGCCGAGGTGGACCTGCCACAGTCAGAGAGCGTGATGAACAAGATCATGCGCGATGCCA
CGCAGGAGATCATCTCGGGGGCGAAATGGGTGGGCCAGCAGGGCTGGCAGGCCTTTAACAACTACTGGAAGGGCACGCCG
GGACTCTCGACAGCGCAGTCCGCCCGGAGCGACGCGGCCCAGTTCCCGCCGACACACGGCGCGGTGACGCAGTCGGCCGT
CTCGAAAGAGCCCGGGCTTGTGTCGGTGGTGGACGTGACGGCTCTCGGGGGCTCTGCCACGGTGCATCCGCTGGCGACGT
TTTCGCCGCCGCTCGGCTGCAGTTTCCTATCGTTTTCACCGTCAGGCCTGTGGCTGTTCACGGCCAGCACCAAGGGCGAC
GTGCAGACGGTGTGGGACCTGATGCGCGTGCAGCACACCAAGGCATCGCCACTGCAGGTGTTGGGCGGTCCGGGAGGGCC
GGGCACGCTGACGGGATCGCGGGTGCGACAGATTGCGCAGTTTTCGCGCATGACAGTGGCACGTATCGTCGACGTGGCCT
GGACGAAGCCGAACGGCGAGCGGCTGGCCATGGTGACGGAGCGCGGTACTGTGCACATCCTGGACCTGCCGTCGAGCGCG
TTTACGTGGCCGCCTCCACGGCGCCGGACCAACAGCACGGCGCCGGACACGAGCACGACGACGGGCAACAACAGCGGCAT
CAGCGGCATCGGCAGTATCGGCAGCATGGGTGGCGGCAACGCTGGCTCCGGGGGGGCCGACACGAGCACAGGAAGACCTG
CGTCGATGGTGGCGGTATCATATGCATCCAGCGCGCTGAGCACGGCCTTTGACGCGGCACGACCACTGCTGGCACGACCC
CGGCGAAGCAGCGCGAACGTGCCACAGTCGACGGGAGCGACGATTGTCGACCATGCCAGCCACGGCGGCAAGATGCTTGC
GGCGGGCATAAGCCACTCGCTAGGAAAGACGGGCAACGCGATCAACCAGCTGCGACACAATGGCGAAAACCGGGTGTCGC
TGCCGGCCGGTTCGTTTGCTCCGGGACCGGCATGCGTGGTGTGGCTGACGGGAAAGCGGTCGCACGCGCTGTTCGTGCTG
GGCGACGGGCTGGTGCGCAGTTTTGCCAGCCGCAGTCGCCGCAAGACGTCAGGACAGCGGACGCTGCATCTCAGTCTGAA
CAAGGACTTCCGGCTGCCTTTCCTGCCGGACGACATGCTCGCGGCAGCCATCAAGCGTCTCCTGGAGCCGGACGAGTACC
TGGACTTTGAGCACGGCGACGGCGAGGCCGGCAGCAACACGATGGTGCTGCTGGACAGCCGACAGCGCCTGACAATGCTG
GAGTCGTCCATTCCACAGGCCGAGATCGAGTCGAGCGCCCCGTACCAGCCCTTCCACACGGACCGACGGGTGGCACTGTA
CGAGTTTGAGGACGGAGCCCACGTTCATGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGTAGTAGTGCCCGTGTCTCGAT
CGGCCACGCCGGTGAGCGTGACGGAACCGACCGAAGCGGGTGTTGTGGACGAGGACGGGTCTGTGTCGCAGTCGCAGCCG
TCGACGAGGAAAAAGCCGAAGAAGACGGCCCGGATTGCCGCAGCCATAGAGGCCTTCCGAGCCCAAGAGGCAGCGGTGTC
GCCGACTGTGCCGACGGCCTGGGCGTTTGGACAGCCGATTGCGTCGACGCTCGTGGACACGGGCTATGCCGGTCTGGCCG
AGGAGAGCTTGTTTAGCATCGGGTTCGAGGAGACGCGGGCACTGCCGGCATCGGCCATGGAGCGGGTGCTGCAGCACGAC
GGCGAGAACGAGCAGATTGTGGTGACGACGCGGCGACGACGCGGTGGCGGTCGTCTGGCGGCCGACGACGGCGACGATGA
CGGCTTCTTCGAGGACGACTGCGAGGTGCTCGACTTTGCCGACCAGCGGGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62